ID: 1070808617

View in Genome Browser
Species Human (GRCh38)
Location 10:79286022-79286044
Sequence TGGGGCCGTTTTGGCTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070808610_1070808617 9 Left 1070808610 10:79285990-79286012 CCTTGGTGCTTCTGTGGGTGGAG No data
Right 1070808617 10:79286022-79286044 TGGGGCCGTTTTGGCTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070808617 Original CRISPR TGGGGCCGTTTTGGCTGGAC AGG Intronic