ID: 1070808832

View in Genome Browser
Species Human (GRCh38)
Location 10:79287044-79287066
Sequence GGCCCATGTCCTAGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070808832_1070808835 -9 Left 1070808832 10:79287044-79287066 CCAGCACACCTAGGACATGGGCC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1070808835 10:79287058-79287080 ACATGGGCCTTGAGGACAGCAGG No data
1070808832_1070808837 -1 Left 1070808832 10:79287044-79287066 CCAGCACACCTAGGACATGGGCC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1070808837 10:79287066-79287088 CTTGAGGACAGCAGGTGTCCAGG No data
1070808832_1070808839 1 Left 1070808832 10:79287044-79287066 CCAGCACACCTAGGACATGGGCC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1070808839 10:79287068-79287090 TGAGGACAGCAGGTGTCCAGGGG No data
1070808832_1070808838 0 Left 1070808832 10:79287044-79287066 CCAGCACACCTAGGACATGGGCC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1070808838 10:79287067-79287089 TTGAGGACAGCAGGTGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070808832 Original CRISPR GGCCCATGTCCTAGGTGTGC TGG (reversed) Intronic
900429522 1:2595224-2595246 GGCCCATGTCCACGGTGTGGGGG + Intronic
901878732 1:12181637-12181659 GTCCCCTTTCCCAGGTGTGCTGG - Intronic
904470845 1:30735318-30735340 GGCATATGTCCTAGGCCTGCTGG - Intronic
904604239 1:31690269-31690291 GGCCCTAGGCCTAGGGGTGCTGG - Intronic
908011667 1:59784858-59784880 GTCCCCTTTCCTAAGTGTGCCGG - Intergenic
909359680 1:74745839-74745861 GGCCCTTGTCCTTGGCTTGCAGG + Intronic
909392965 1:75136610-75136632 GGCTCATGTCAGAGGAGTGCGGG + Exonic
909461236 1:75916810-75916832 GGTACATGTCCAAGATGTGCAGG - Intergenic
910641207 1:89464420-89464442 GGGCCATGACCAAGGAGTGCAGG + Intergenic
912637294 1:111309146-111309168 GGTGCATGTGCAAGGTGTGCAGG - Intronic
913691137 1:121281032-121281054 GGCACATGGCCCAGGAGTGCTGG + Intronic
914146404 1:144998930-144998952 GGCACATGGCCCAGGAGTGCTGG - Intronic
914197139 1:145453361-145453383 GGTCCATCTTCTAGATGTGCTGG + Intergenic
915076165 1:153309594-153309616 ACCCCAAGTCCAAGGTGTGCTGG + Intronic
915319837 1:155050708-155050730 CGCCCGAGTCCTACGTGTGCCGG + Exonic
915461511 1:156073232-156073254 TGCCCAGGTACTAGGGGTGCAGG + Exonic
915750274 1:158201424-158201446 GGTAAATGTCCTATGTGTGCAGG - Intergenic
920478461 1:206299508-206299530 GGCACATGGCCCAGGAGTGCTGG + Intronic
921347072 1:214197209-214197231 GGCCCATGTTTTAGGGGTGCTGG - Intergenic
921546273 1:216478467-216478489 GGCCCATGGCCTAGGGGTAGGGG + Intergenic
922327882 1:224545943-224545965 GGCCCCTCTCCTTGGTTTGCAGG + Intronic
924039727 1:239972603-239972625 GGCCCATGGCCTGGGCTTGCAGG + Intergenic
924844341 1:247750118-247750140 GGCTCATAGCCTAGGTCTGCAGG - Intergenic
1066161114 10:32730017-32730039 GGTACATGTCCAGGGTGTGCAGG + Intronic
1070492977 10:76994795-76994817 GGCAAATGTCCTAAATGTGCTGG + Intronic
1070808832 10:79287044-79287066 GGCCCATGTCCTAGGTGTGCTGG - Intronic
1072886127 10:99275825-99275847 GTCCCATGCCCTAGATGTTCTGG - Intergenic
1075630745 10:123999428-123999450 GGCCCATGCCCGAGGGGTGGGGG + Intergenic
1076983034 11:215267-215289 TGCCCATGTGCTAGGTGTGGTGG + Intergenic
1077239286 11:1502288-1502310 GGCCCCTGGCCTGGGTGGGCTGG - Intergenic
1078487794 11:11740126-11740148 GGCCCATGTCCCAGGTATCTGGG - Intergenic
1079396514 11:20068265-20068287 GGTCCATTTCCAAGGTGAGCAGG - Intronic
1083579836 11:63818019-63818041 GGCTCAGGTCCAAGGTGTGAGGG - Exonic
1084040470 11:66539663-66539685 GACCCAGGTCATAGGAGTGCTGG + Exonic
1085035032 11:73294560-73294582 AGCCCATATGCTAGGGGTGCTGG - Intronic
1087596907 11:100265452-100265474 GGCCCATGACCTAGTGGAGCTGG - Intronic
1089076150 11:115740445-115740467 AGCCAATTTCCTAGGTGTCCTGG - Intergenic
1089701610 11:120247871-120247893 GGCCCATTGCCCAGGTGTGTGGG + Intronic
1092768231 12:11872240-11872262 GCCCCATGACCGAGGTGTGCAGG + Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094267221 12:28572904-28572926 AGCCCATGTCCGGGGTGGGCAGG + Intronic
1097024031 12:56040966-56040988 TACCCTTGTCATAGGTGTGCTGG - Intergenic
1102678268 12:114673142-114673164 AGACCCTGTCCTAGGTGGGCAGG - Intronic
1104624000 12:130338158-130338180 GGCTGAGGTGCTAGGTGTGCGGG + Intronic
1107698883 13:43027267-43027289 GGTACATGTGCTAGATGTGCAGG + Intronic
1115928232 14:38461753-38461775 GGTACATGTTCTAGATGTGCAGG + Intergenic
1118623278 14:67633698-67633720 GGCCCAGGTCCTAAATGTGGTGG - Intronic
1120189320 14:81426090-81426112 TGCCCATCTCATAGGTGTGAGGG - Intronic
1122824561 14:104363273-104363295 GGCCCCAGACCCAGGTGTGCTGG - Intergenic
1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG + Intergenic
1123489007 15:20765076-20765098 GGCACATGCCATAGGTCTGCTGG - Intergenic
1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG + Intergenic
1123545506 15:21334163-21334185 GGCACATGCCATAGGTCTGCTGG - Intergenic
1125723344 15:41855682-41855704 GGCCCATGTCCTCGCTGTCCAGG + Exonic
1127148559 15:56050420-56050442 GGCCTTTGTCATCGGTGTGCAGG + Intergenic
1130048716 15:80465794-80465816 GTCCCATGTCCTAGGGTTCCTGG + Intronic
1132306884 15:100821697-100821719 TGCCCATGGCCTGGGTGGGCAGG - Intergenic
1202953851 15_KI270727v1_random:61434-61456 GGCACATGCCATAGGTCTGCTGG - Intergenic
1135424858 16:22327345-22327367 GACCCATGTGCTGGGTGGGCAGG - Intronic
1138833897 16:60409882-60409904 GATCCATGTGCTAGGAGTGCAGG + Intergenic
1141403832 16:83774165-83774187 GACCAATGTCCTAGGCTTGCTGG - Intronic
1142139957 16:88468470-88468492 GGGCCAGGTCCCAGCTGTGCCGG + Intronic
1142224499 16:88870993-88871015 AGCCCATGCCCTGGGTCTGCAGG - Intergenic
1203141998 16_KI270728v1_random:1772718-1772740 TGCCCATCTCCTAGGGCTGCTGG - Intergenic
1142509043 17:383181-383203 AGCCCCTGGCCCAGGTGTGCAGG - Intronic
1142701459 17:1664463-1664485 GGTGCCTGTCCTATGTGTGCTGG - Intronic
1143095557 17:4476714-4476736 GCCCCATGTCCTAGGCCTGAGGG + Intronic
1143173856 17:4945471-4945493 GGCCTAAGTCCTCAGTGTGCTGG - Intergenic
1150216923 17:63476454-63476476 GCCCCAAGCCCCAGGTGTGCCGG + Intergenic
1151496949 17:74463603-74463625 GGCCCATTTCCCAGGGGTGAGGG - Intergenic
1154221545 18:12459295-12459317 AGCCCATGCCCTGGTTGTGCAGG + Intronic
1159586268 18:70286463-70286485 GGCACATATCTTAGCTGTGCTGG + Intergenic
1161473771 19:4473594-4473616 GGGCCATGTGCTAGGGGTCCAGG + Intronic
1161944815 19:7429006-7429028 GGCCCGTGGCCTAGGCCTGCGGG - Intronic
1162438692 19:10679644-10679666 GGCCCCTGTCCTAGATGCCCTGG + Intronic
1163466147 19:17469717-17469739 GGCCTAGGTCCTAGGGGGGCCGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163798779 19:19352743-19352765 GGCCCATGTTTTAGGTGTTGTGG + Intronic
1164728533 19:30483509-30483531 GGACCATGCCCTGGGTGTTCTGG - Intronic
1165187476 19:34034472-34034494 GGGCCCTGTCCTTGGTGTGTCGG - Intergenic
1165437720 19:35805753-35805775 GGCTCATGTCCAAGATCTGCAGG - Intronic
925740022 2:6996944-6996966 GGGCCAGGTCCCAGGTGGGCCGG - Exonic
925880872 2:8351244-8351266 GGCCCATGAGCTAGGTTTTCTGG - Intergenic
934105618 2:88692011-88692033 GGCGCATGTCCTTGGCGTGATGG + Intronic
942156875 2:173138647-173138669 GGCCCAGGTCTTTGGTTTGCTGG + Intronic
942642951 2:178079173-178079195 GGCACATGTGCAGGGTGTGCGGG + Intronic
944651293 2:201832854-201832876 TGCCCATGTCCCAGGAATGCTGG + Intronic
947827007 2:233113315-233113337 GCCCCAGGTCCAAGGTCTGCTGG + Intronic
948167982 2:235877951-235877973 GGGCCCTGCCATAGGTGTGCAGG - Intronic
948609041 2:239155268-239155290 GGCCCATGTCCCAGGTGGAGTGG - Intronic
1173250384 20:41361339-41361361 GGGCAATGTCCTGCGTGTGCTGG + Exonic
1176431555 21:6579287-6579309 GGCCCATGGGCCAGGTGTGGAGG + Intergenic
1179706949 21:43186749-43186771 GGCCCATGGGCCAGGTGTGGAGG + Intergenic
1181545635 22:23600566-23600588 GGCCCATTTCCCAGCTGGGCTGG + Intergenic
1181814675 22:25429333-25429355 GGCCCATTTCCCAGCTGGGCTGG - Intergenic
1181949904 22:26546341-26546363 CGCCCATGTCCCAGGAGTGCCGG - Intronic
1182316984 22:29454279-29454301 GGTCTGTGTGCTAGGTGTGCCGG + Intergenic
1183785805 22:40028498-40028520 AGCCCATGTCCTCGGAGCGCTGG - Intronic
1184967740 22:47993643-47993665 GGCTCACATCCTAGGTGTTCAGG + Intergenic
952883851 3:38001220-38001242 GGCCCATCTCCCAAGTGTGGTGG + Intronic
954703787 3:52467501-52467523 GGCCCATGTGCTAGGTTTGGGGG + Intronic
961384149 3:126515295-126515317 GGCCCATCTCCCAGTTGTCCAGG - Intronic
963044902 3:141095174-141095196 TGCCTGCGTCCTAGGTGTGCGGG + Intronic
963767093 3:149348549-149348571 TGCCCATGTCCTAGCTTTGGTGG + Intergenic
963806189 3:149725476-149725498 GGTCCAGGCTCTAGGTGTGCAGG + Intronic
964417013 3:156458239-156458261 GGCGCATTTCCTATGTGTTCTGG - Intronic
967154279 3:186678273-186678295 GGCACATGTGCAGGGTGTGCAGG + Intergenic
968411212 4:392076-392098 GGAGCATGTACTATGTGTGCAGG - Intergenic
968517053 4:1019755-1019777 GGCCCATGGCCTGGGTGGGAGGG + Intronic
968576086 4:1366804-1366826 GGCCGGTGTGCTGGGTGTGCAGG - Intronic
968688481 4:1977115-1977137 AGCCCCTGTCCTGGATGTGCAGG + Intronic
972846875 4:43001762-43001784 GGTGCAGGTCCTTGGTGTGCTGG - Intronic
973648790 4:52976650-52976672 GTCCCATGTCATAGGTGTTTGGG - Intronic
974994378 4:69135403-69135425 GGCACATGTGCAAGATGTGCAGG + Intronic
975663551 4:76710806-76710828 TTCCCATGTGCTAGGTGTCCTGG + Intronic
976113856 4:81705890-81705912 GGTACATGTGCCAGGTGTGCAGG - Intronic
985576980 5:678098-678120 GGGCCATGTCCCAGCTGAGCCGG + Intronic
985591900 5:770151-770173 GGGCCATGTCCCAGCTGAGCCGG + Intergenic
993704843 5:91158180-91158202 TGCCCATGTCCTAGGCTTTCTGG + Intronic
997693516 5:135843899-135843921 GACCCAGGGCCTGGGTGTGCAGG - Intronic
997732044 5:136188788-136188810 GGCCCATGTCACAGGTGTTTGGG - Intergenic
998294459 5:140953806-140953828 GGTGCATGTGCTAGTTGTGCAGG + Intronic
1000247691 5:159462539-159462561 GGGCGAGGTCCTAGGTTTGCTGG + Intergenic
1001403438 5:171460022-171460044 GGCCTCTGTCCTGGGTCTGCAGG + Intergenic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1018735716 6:166685932-166685954 GGCCCATGCCCTAGGAGGGAGGG + Intronic
1019351827 7:557621-557643 CGCCCATGTCGTGGGAGTGCTGG - Intronic
1019502090 7:1369513-1369535 GGCCAAGGTCCTAGGTGGGCTGG - Intergenic
1019607439 7:1917238-1917260 GGCCCATGTGCTGGCAGTGCAGG - Intronic
1022632002 7:32094074-32094096 CCCCCATGGCATAGGTGTGCTGG + Intronic
1028763721 7:94526210-94526232 GTTGCATGTCCTAGGTGGGCTGG + Intronic
1029417139 7:100450419-100450441 GGCTAATGTCGTAGGGGTGCTGG + Intergenic
1031128624 7:117804888-117804910 GGCACATGTGCAAGATGTGCAGG - Intronic
1035390923 7:158504220-158504242 GGTCCATGTCCAGGATGTGCAGG + Intronic
1036263214 8:7256605-7256627 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036264517 8:7264227-7264249 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036265816 8:7271849-7271871 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036267118 8:7279471-7279493 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036268421 8:7287093-7287115 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036269725 8:7294715-7294737 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036298165 8:7552339-7552361 GGCCCGTGGCCTAGGTATGGGGG + Intergenic
1036299470 8:7559989-7560011 GGCCCGTGGCCTAGGTATGGGGG + Intergenic
1036300775 8:7567637-7567659 GGCCCGTGGCCTAGGTATGGGGG + Intergenic
1036302082 8:7575283-7575305 GGCCCGTGGCCTAGGTATGGGGG + Intergenic
1036303377 8:7582930-7582952 GGCCCGTGGCCTAGGTATGGGGG + Intergenic
1036315259 8:7715144-7715166 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036316561 8:7722792-7722814 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036317868 8:7730440-7730462 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036319177 8:7738088-7738110 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036320484 8:7745735-7745757 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036321794 8:7753383-7753405 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036323103 8:7761031-7761053 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036324405 8:7768678-7768700 GGCCCGTGGCCTAGGTATGGGGG - Intergenic
1036352938 8:8023275-8023297 GGCCCGTGGCCTAGGTATGGGGG + Intergenic
1036354228 8:8030922-8030944 GGCCCGTGGCCTAGGTATGGGGG + Intergenic
1038617953 8:29112742-29112764 GCCCCATTTCCCAGCTGTGCTGG + Intronic
1039079717 8:33722730-33722752 GGCCCAGGTCCTGGTGGTGCTGG + Intergenic
1039878827 8:41610608-41610630 GGTCCAGGTCCCAGGTGAGCAGG + Intronic
1042643751 8:70962993-70963015 GGTACATGTGCAAGGTGTGCAGG + Intergenic
1044790557 8:95842559-95842581 GGCCCATTTAATAGGTGTGTAGG - Intergenic
1048898662 8:139017281-139017303 GGCTGAAGTCCTGGGTGTGCAGG + Intergenic
1049206970 8:141368098-141368120 GGCCCAGATGCCAGGTGTGCAGG - Intergenic
1049264302 8:141659186-141659208 GGCCCATGTCCTAGCAGGGGTGG + Intergenic
1052137742 9:24936513-24936535 GGCTCATGTCCCAGGATTGCTGG + Intergenic
1054827271 9:69585820-69585842 GTCCCAAGTCCTAGGAGTACAGG - Intronic
1056547855 9:87627765-87627787 TGCCCAGGTCCTAGGTTTACAGG - Intronic
1057139752 9:92719228-92719250 GGCCCTTCTCCTCGGCGTGCTGG + Exonic
1057592273 9:96383223-96383245 GCGCCCTGTCCTAGGTGGGCTGG - Intronic
1057937345 9:99251926-99251948 CACTCATGTCCTAGGTGGGCAGG - Intergenic
1059607293 9:115847719-115847741 GGCACATGTCTTAGGAGAGCTGG + Intergenic
1061298287 9:129689055-129689077 GGCTCATGGCTTAGGGGTGCTGG + Intronic
1061962495 9:133995160-133995182 AGCCCATCTCCAAGGTGTGATGG - Intergenic
1062233692 9:135497952-135497974 GCCCAGTGTCCCAGGTGTGCAGG + Intronic
1062697592 9:137883481-137883503 GGTCCATCTTCTAGATGTGCTGG - Intronic
1187741691 X:22363007-22363029 GGTTCATGTCCTAGGTCTGTGGG - Intergenic
1192523731 X:71823959-71823981 GGACCATGAGCAAGGTGTGCCGG - Intergenic
1192796752 X:74429851-74429873 GGCCCATGTCCCTTGTGTGGAGG + Intronic
1194484321 X:94468987-94469009 GGCCCATCTGCTAAATGTGCAGG + Intergenic
1196150256 X:112365749-112365771 GGCCCATTGCCTATGTGGGCAGG - Intergenic
1200234419 X:154461416-154461438 GGCCCAGGCCCTGGGCGTGCCGG + Exonic
1200738317 Y:6825633-6825655 GTCTCATTTCCTAGGTGTGCTGG + Intergenic
1201672850 Y:16543702-16543724 GGCACATGTCCAAGATGTGCAGG + Intergenic