ID: 1070810509

View in Genome Browser
Species Human (GRCh38)
Location 10:79295372-79295394
Sequence GACCACCCAGTGCTGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 0, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070810509_1070810513 5 Left 1070810509 10:79295372-79295394 CCCAGCTACAGCACTGGGTGGTC 0: 1
1: 0
2: 3
3: 0
4: 142
Right 1070810513 10:79295400-79295422 CTATGCGGCCTGATCCTGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 51
1070810509_1070810515 13 Left 1070810509 10:79295372-79295394 CCCAGCTACAGCACTGGGTGGTC 0: 1
1: 0
2: 3
3: 0
4: 142
Right 1070810515 10:79295408-79295430 CCTGATCCTGTCTGGAAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 161
1070810509_1070810511 -10 Left 1070810509 10:79295372-79295394 CCCAGCTACAGCACTGGGTGGTC 0: 1
1: 0
2: 3
3: 0
4: 142
Right 1070810511 10:79295385-79295407 CTGGGTGGTCACAGCCTATGCGG 0: 1
1: 0
2: 1
3: 21
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070810509 Original CRISPR GACCACCCAGTGCTGTAGCT GGG (reversed) Intronic
901716272 1:11157185-11157207 GACGACCCAGAGCTGATGCTGGG - Exonic
903672711 1:25046048-25046070 GTCCACCCGGGGCTGGAGCTGGG + Intergenic
905209083 1:36361100-36361122 GACCACACACTGCTGTGGGTGGG + Intronic
906153047 1:43598909-43598931 CACCACCCAATGCTGCACCTGGG - Exonic
907290644 1:53410339-53410361 GGCCCCCTAGTGCTGCAGCTTGG + Intergenic
909318572 1:74253663-74253685 GCCCACCCAGAACTCTAGCTGGG + Intronic
909330156 1:74400014-74400036 GACCACCCAGTTTTGAGGCTGGG + Intronic
910702243 1:90088716-90088738 AAACACACAGTGCTGTATCTGGG - Intergenic
920348042 1:205319204-205319226 GACCACCCAGTTCTGCAGCTGGG - Intronic
1065571423 10:27073938-27073960 AAGCACCCAGAGCTGAAGCTAGG + Intronic
1066096737 10:32079321-32079343 GAGCACCCAGGGCTATAGATAGG + Intergenic
1066642882 10:37574002-37574024 CACCACACATTGCTGTAGTTGGG - Intergenic
1068087470 10:52392348-52392370 GACCAACCTGTGCTGCAGGTAGG + Intergenic
1070810509 10:79295372-79295394 GACCACCCAGTGCTGTAGCTGGG - Intronic
1071566174 10:86672505-86672527 GAGCACGCAGTGCTGTTTCTTGG + Intronic
1075593950 10:123713825-123713847 TACCACCCAGGGCTGGAACTAGG - Intronic
1077046880 11:550639-550661 GACCACCCTATGCAGTATCTCGG + Intronic
1077893314 11:6435343-6435365 GACTGCCCCATGCTGTAGCTGGG + Intronic
1078595263 11:12680953-12680975 GATCACCCATTACTGTGGCTGGG + Intronic
1078856621 11:15210650-15210672 GAAAACACAGTGCTGTTGCTGGG + Intronic
1079400608 11:20103590-20103612 GACCACCTTGTTCTCTAGCTTGG + Intronic
1079716720 11:23756793-23756815 CAACACCCAGTGCTGTATGTTGG - Intergenic
1081252354 11:40850983-40851005 GTCCACCCAGGGCTCCAGCTTGG - Intronic
1081806536 11:45893895-45893917 GACCCCCCAGGGTTTTAGCTGGG + Intronic
1083132167 11:60634592-60634614 CACCACCCAGAGCTGAAGTTAGG + Intergenic
1092404347 12:8207844-8207866 GATCACCCAGTGATCTAGCGAGG + Intergenic
1093285971 12:17263769-17263791 GACTTCCCAGTGCTTTATCTTGG - Intergenic
1100184403 12:92123412-92123434 GAGCACTTAGTGCTGTGGCTGGG - Intronic
1100468191 12:94867181-94867203 GACCACCATGTGAAGTAGCTAGG + Intergenic
1102960193 12:117087680-117087702 AACCACCATGTGCTTTAGCTGGG + Intronic
1105214017 13:18273989-18274011 GCCCAGCCAGTTCTGTGGCTGGG - Intergenic
1108156904 13:47594585-47594607 GAACAGCCAGTGCTATAGTTTGG - Intergenic
1109062056 13:57632387-57632409 GACCACCGGGTGCCGCAGCTCGG + Exonic
1111687507 13:91519385-91519407 GACCCCCCAGTGTTGGAGCAAGG + Intronic
1112494253 13:99893289-99893311 GAGCACCCATTGTTGCAGCTAGG + Exonic
1117331407 14:54715970-54715992 GATCACCAAGTTCTGTTGCTTGG + Intronic
1117805201 14:59483982-59484004 GGCCACGCAGTGCTGGCGCTGGG - Exonic
1118084945 14:62404047-62404069 GACCCCCCAGTGTTGGAGGTGGG + Intergenic
1119261417 14:73240142-73240164 GACCACCCAGCCCTGCACCTTGG - Intronic
1121412972 14:93760558-93760580 GGGCACCAAGTGCTGTAGATGGG - Intronic
1121997705 14:98616691-98616713 GGCCACTCAGTGCCGGAGCTGGG + Intergenic
1124626657 15:31311701-31311723 GACCACCCGGGGCTGCAGCAGGG - Intergenic
1129268894 15:74409378-74409400 GGCCACCCAGGGCAGTGGCTGGG - Exonic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1132975985 16:2711476-2711498 GACCACCCAGTGCTGCTCCCTGG + Intergenic
1137338026 16:47571010-47571032 AAGCACCCAGAGCTGAAGCTAGG - Intronic
1140031570 16:71343490-71343512 GTCCACCCAGTGCTCTAGGAAGG + Intergenic
1145230637 17:21171113-21171135 GAGCACCATGTGCTGTCGCTGGG - Intronic
1147520199 17:41163785-41163807 CACCAGCCAGTGCTGAAGCAGGG - Intergenic
1147948937 17:44096261-44096283 GACCTCCCTGGGCTGTAGCGAGG - Intronic
1148740262 17:49888876-49888898 GCCCACCCAGTGCTGTGTGTGGG + Intergenic
1150602692 17:66664298-66664320 GACCACCAAGTCCTGTGGCCTGG + Intronic
1152063802 17:78098686-78098708 GTCCATCCAGGGCAGTAGCTGGG + Intronic
1155865213 18:30956382-30956404 TCCCACCCCGTCCTGTAGCTGGG - Intergenic
1157192292 18:45591655-45591677 AAGCACCCAGTGCTGCTGCTGGG + Intronic
1160819969 19:1053347-1053369 GGGCACCCAGTGCTGTACCAGGG - Exonic
1161383106 19:3976936-3976958 GACAACCCTGTGCTACAGCTCGG + Intronic
1162390524 19:10387034-10387056 GATCACACAGTGATGGAGCTGGG - Intergenic
1165108132 19:33486480-33486502 GCTCACCCAGTGATGTGGCTCGG - Intronic
1167410455 19:49341003-49341025 GAAAAGCCAGTGCTGTACCTGGG + Exonic
926782335 2:16484839-16484861 CAGTACCCAGTGCAGTAGCTGGG - Intergenic
928111448 2:28513004-28513026 GACCACCTCTTGCTGTAACTGGG + Intronic
928117461 2:28556939-28556961 GACCACCCAGTGCTGTAACCCGG - Intronic
930638333 2:53829912-53829934 GTCTTCCCAGTGCTGGAGCTTGG + Intergenic
934300306 2:91772760-91772782 GCCCAGCCAGTTCTGTGGCTGGG + Intergenic
934857687 2:97739306-97739328 GCCCACCCACTGGTGAAGCTGGG + Intronic
935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG + Intergenic
935670702 2:105554827-105554849 GAGAAGCCAGTGTTGTAGCTGGG + Intergenic
938729539 2:134135778-134135800 CACCACCCATGGCTGTGGCTCGG - Intronic
1173150644 20:40563813-40563835 GAACACCCAGGGCTGTTTCTTGG + Intergenic
1173383350 20:42565977-42565999 CATCACACAGGGCTGTAGCTAGG + Intronic
1173553970 20:43952482-43952504 GATCACTCAGGGCTGTAGGTTGG + Intronic
1174904116 20:54532196-54532218 GACAACCCAGTGTGGTAGATAGG + Intronic
1178416142 21:32406687-32406709 GGCCAGCCTGGGCTGTAGCTGGG - Intergenic
1178705286 21:34867997-34868019 GGCCACACAGAGCTGCAGCTGGG + Intronic
1181638839 22:24186517-24186539 GACCACCCAGGCCTCTAGCCAGG - Intronic
1181698660 22:24607893-24607915 GCCCAGCCAGTTCTGTGGCTGGG + Intronic
1183337814 22:37260646-37260668 GACCACCCAGAGCTGGAGGATGG - Intergenic
1183486856 22:38092748-38092770 GACCCCCCAGTGTTGGAGGTGGG + Intronic
1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG + Intergenic
1184430844 22:44440905-44440927 GACCACCCAGGGCTGCACTTGGG - Intergenic
1184448264 22:44567029-44567051 GACCGGCCGGTGCCGTAGCTGGG - Intergenic
1184466308 22:44670381-44670403 AGCCAGCCAGTGCTGGAGCTGGG - Intronic
1185386318 22:50532635-50532657 CACCACCCAGTGCCGCCGCTGGG + Intergenic
949962871 3:9328773-9328795 GACTACCCCACGCTGTAGCTCGG - Intronic
950188337 3:10959059-10959081 GACCTCCCAGGGCTGTAGGAAGG + Intergenic
950775893 3:15350164-15350186 TAACACCCAGTGCTGGAGATGGG + Intergenic
952017333 3:28973297-28973319 TACCAACCACTGCTGTAGGTAGG - Intergenic
953943154 3:47120297-47120319 GCCCAACCAGTGCTGAACCTGGG + Exonic
954628819 3:52037337-52037359 GGCTAGCCAGGGCTGTAGCTGGG - Intergenic
954852845 3:53618008-53618030 GCCCAGCCAGAGCTGTGGCTCGG - Intronic
955930143 3:64048166-64048188 GACCAGTCTGTGCTGTGGCTTGG - Intergenic
957879533 3:86193315-86193337 GACCACCCAGTGATTCAGTTTGG + Intergenic
962465274 3:135651668-135651690 GACCATCAAGTGCTGGAGATAGG + Intergenic
962756729 3:138470543-138470565 GACCAACAAGTGGTGGAGCTGGG + Intronic
962899027 3:139741020-139741042 GGCCACACAGTGCTGACGCTGGG - Intergenic
969761710 4:9189855-9189877 GATCACCCAGTGATCTAGCAAGG - Intergenic
970528233 4:16954793-16954815 GACCCCCCAGTGTTGGAGGTGGG - Intergenic
974392375 4:61288600-61288622 TACCACCCTGTCTTGTAGCTAGG - Intronic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
984195850 4:176657663-176657685 ACCCACCCAGACCTGTAGCTAGG + Intergenic
984499079 4:180535621-180535643 GTCCAGCCAGTTCTGTAGCAGGG + Intergenic
986202000 5:5587519-5587541 GAGGACTGAGTGCTGTAGCTTGG + Intergenic
989599927 5:43192000-43192022 GGACACCCAGTGCAGTCGCTCGG - Intronic
990340107 5:54813665-54813687 GACCCCCGAGTGGTGTAACTGGG + Intergenic
996884847 5:128342616-128342638 GACAACCCAGAGCAGGAGCTGGG + Intronic
997591397 5:135075027-135075049 GACCTCCCAGTTCTGTTGCCTGG + Intronic
998388818 5:141773944-141773966 GCCCTCCCAAAGCTGTAGCTTGG - Intergenic
998889721 5:146733250-146733272 GACCACCCAGCCCTGTACTTTGG - Intronic
1001584653 5:172825462-172825484 GACCACTCAGGGCAGAAGCTGGG + Intergenic
1003098960 6:3162873-3162895 GACCACCTAGTTCTGGAGCCAGG + Intergenic
1007177389 6:39906313-39906335 GCCCACCCAGGCCTGGAGCTGGG - Exonic
1008816956 6:55579496-55579518 GAGCACCCAAGGCTGCAGCTGGG - Intergenic
1013722953 6:113053270-113053292 GAACACCCTGTGATTTAGCTTGG - Intergenic
1017485545 6:154898785-154898807 CACCACCCAGGGCTGTGGGTAGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1019224246 6:170497015-170497037 GAGGACCCAGTCCTGGAGCTGGG - Intergenic
1020213447 7:6171747-6171769 CAGCGCCCAGTGCTGTAGGTGGG - Intronic
1020592536 7:10159355-10159377 GACCATCCAGTGCAGTTTCTTGG - Intergenic
1023582955 7:41701231-41701253 TACCACCTAGGGCTGTGGCTTGG - Intronic
1023588626 7:41757927-41757949 GACTGCCCTGTGCTGTAGTTTGG - Intergenic
1023987663 7:45106335-45106357 CACTACCCAGAGCTGTAGCCAGG - Intronic
1026815141 7:73505116-73505138 AACCACCCAGAGCTGCAGCGGGG - Intronic
1028001206 7:85500727-85500749 AACTGCCCAATGCTGTAGCTTGG + Intergenic
1034951661 7:155301094-155301116 CACCACCCAGTACTGGGGCTGGG - Intronic
1036271799 8:7311680-7311702 GATCACCCAGTGATCTAGCGAGG - Intergenic
1036349549 8:7998666-7998688 GATCACCCAGTGATCTAGCGAGG + Intergenic
1036844822 8:12159169-12159191 GATCACCCAGTGATCTAGCGAGG + Intergenic
1036866193 8:12401501-12401523 GATCACCCAGTGATCTAGCGAGG + Intergenic
1037728170 8:21501271-21501293 GCCCACACAGTGCTGGAGCAGGG + Intergenic
1039207217 8:35170538-35170560 AAGCACCCAGAGCTGAAGCTAGG + Intergenic
1039983574 8:42429076-42429098 GACCACACACTGCAGTAACTGGG + Intronic
1040055515 8:43054106-43054128 TATCACCCAGTGCTATAGTTTGG - Intronic
1040862485 8:52014057-52014079 AACCACCCAGTGCTGTGTATTGG + Intergenic
1049228758 8:141471098-141471120 GGCCACCCAGCGCTGCAGCCTGG - Intergenic
1050621472 9:7456564-7456586 GAAAACACAGTGCTGTAGCCTGG + Intergenic
1057097013 9:92320306-92320328 GAGCACACAGTGCTGCTGCTTGG - Intronic
1060889137 9:127177224-127177246 GCCCACCCAGAGCTGCAGCCTGG - Intronic
1061241401 9:129375673-129375695 GATCACCCAGTACTGGAGTTTGG - Intergenic
1062526909 9:136981579-136981601 GACTCCCCAGGGCTGAAGCTGGG + Exonic
1189949470 X:46213912-46213934 GACCCCCCAGTGTTGGAGGTGGG - Intergenic
1190651669 X:52574281-52574303 GGCCACCCAGTCCAGTTGCTTGG + Intergenic
1197028000 X:121778947-121778969 AAGCACCCAGAGCTGAAGCTAGG - Intergenic
1199978844 X:152909722-152909744 GGCCACGCAGTGCTGCAGCCTGG - Intergenic
1199994676 X:153014390-153014412 AACTGCCCAGTGCTATAGCTCGG - Intergenic
1200070080 X:153524872-153524894 TATCACCCAGTGCTTTATCTTGG - Intronic