ID: 1070812730

View in Genome Browser
Species Human (GRCh38)
Location 10:79306411-79306433
Sequence ATTTCTGTGCTGATGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070812724_1070812730 1 Left 1070812724 10:79306387-79306409 CCCAAGTCCCTGCAGAGGCACAG 0: 1
1: 0
2: 4
3: 30
4: 307
Right 1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 244
1070812723_1070812730 2 Left 1070812723 10:79306386-79306408 CCCCAAGTCCCTGCAGAGGCACA 0: 1
1: 0
2: 0
3: 37
4: 305
Right 1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 244
1070812727_1070812730 -7 Left 1070812727 10:79306395-79306417 CCTGCAGAGGCACAGAATTTCTG 0: 1
1: 0
2: 1
3: 32
4: 215
Right 1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 244
1070812726_1070812730 -6 Left 1070812726 10:79306394-79306416 CCCTGCAGAGGCACAGAATTTCT 0: 1
1: 0
2: 2
3: 30
4: 233
Right 1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 244
1070812725_1070812730 0 Left 1070812725 10:79306388-79306410 CCAAGTCCCTGCAGAGGCACAGA 0: 1
1: 0
2: 1
3: 36
4: 339
Right 1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070812730 Original CRISPR ATTTCTGTGCTGATGGTGGC AGG Intronic
901892222 1:12276511-12276533 ATTTCTGTGCTCAAGGTGTTTGG + Exonic
902654864 1:17860146-17860168 ACCTCAGTGGTGATGGTGGCTGG + Intergenic
902858187 1:19224600-19224622 ATCCAGGTGCTGATGGTGGCTGG - Intronic
904504051 1:30936215-30936237 ATCTCTGTGCTGATGAAGTCTGG + Intronic
904505515 1:30949644-30949666 ATCTCTGTGCTGATGAAGTCTGG + Intronic
905475252 1:38221857-38221879 ATTTATCTGCTGCTGGTGGAAGG + Intergenic
905875370 1:41428687-41428709 CCTTCTGTTCTCATGGTGGCTGG - Intergenic
906739316 1:48166540-48166562 ATGTCAGTGCTGATGATGACGGG - Intergenic
906861923 1:49370040-49370062 GTTTATGTGATGATGGAGGCTGG - Intronic
907686289 1:56615078-56615100 ATGTCTATTTTGATGGTGGCAGG - Intronic
908319897 1:62968970-62968992 ATTTCTGTGCTGAATGTGCTGGG - Intergenic
910241331 1:85089493-85089515 ATTTCAGCAGTGATGGTGGCAGG - Intronic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
913026103 1:114842275-114842297 ATATCTATGGTAATGGTGGCAGG - Intergenic
915543620 1:156583626-156583648 AATTCTGGGCAGGTGGTGGCAGG + Intronic
915683650 1:157607810-157607832 ATTTCTTTACTTATGGGGGCCGG - Intergenic
916277290 1:163008514-163008536 ATTCCTGAGCTTATGGTGGAAGG + Intergenic
917509110 1:175655680-175655702 GTTTCTTTGCTAATGGTGGTGGG - Intronic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
920952902 1:210589358-210589380 ATTTCTTTCCTGCTGATGGCTGG - Intronic
922892123 1:229070168-229070190 GTGTATGGGCTGATGGTGGCTGG - Intergenic
923093988 1:230760527-230760549 ACTTCTGTGCTATTGGTGACAGG - Intronic
924466075 1:244300248-244300270 ATTTCGGTGGTGGTGGTGGTGGG - Intergenic
1064358314 10:14639798-14639820 ATGACTGTGCTGAGTGTGGCTGG - Intronic
1065467927 10:26045132-26045154 TTTGCTGGGCAGATGGTGGCTGG - Intronic
1066228945 10:33413048-33413070 ATTACTGAACTGATGGGGGCAGG + Intergenic
1068651306 10:59525868-59525890 ATTTCTCTACTGATGGTTGGGGG + Intergenic
1069641006 10:69955540-69955562 ATTGGTGTGTGGATGGTGGCAGG - Intronic
1069828255 10:71267451-71267473 ATTTCTGCACTGATGGTGGGTGG + Intronic
1070183485 10:74037266-74037288 TTTTCTGTTTTGATGGTGACAGG + Intronic
1070785294 10:79159044-79159066 AGTGCTGTGCTGAGGGTGCCTGG + Intronic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1071095488 10:81969185-81969207 ACTGCTCTGCTGGTGGTGGCAGG - Intronic
1073035757 10:100563127-100563149 GGTTCTGTCCTGATGGGGGCAGG + Intergenic
1073690097 10:105799027-105799049 ATTCCGGAGCTGCTGGTGGCAGG - Intergenic
1073939624 10:108680884-108680906 ATCTCTGTGCAGAAAGTGGCTGG - Intergenic
1075281021 10:121138507-121138529 ATTTCTCTGCTGATGGTGTTTGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076483604 10:130801422-130801444 ATTTCTGTGCTGGTGGCTGTGGG + Intergenic
1077906540 11:6538996-6539018 TCCTCTCTGCTGATGGTGGCTGG + Intronic
1084509800 11:69596520-69596542 GGGTCTGTGGTGATGGTGGCTGG - Intergenic
1086322039 11:85660823-85660845 ATTTGTCTTTTGATGGTGGCAGG - Intronic
1087548867 11:99620718-99620740 AATTGTGTGCTGCTGATGGCCGG - Intronic
1088070406 11:105777038-105777060 GTTTATGTGCTGGTGTTGGCTGG - Intronic
1088169107 11:106975564-106975586 ATTGCTGTGATAATGGAGGCTGG - Intronic
1091005526 11:131949807-131949829 AGCTCTGTGCTGATGTTGGATGG + Intronic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1098954435 12:76675083-76675105 CTTGCAGTGCTGATAGTGGCAGG + Intergenic
1099586498 12:84523425-84523447 ATTTCTGTGATGTTGGGGGATGG - Intergenic
1099981656 12:89611314-89611336 ATTACTGTGCGGATGGTCACTGG - Exonic
1100074724 12:90766226-90766248 ATTTGGGTAGTGATGGTGGCAGG + Intergenic
1103212773 12:119178882-119178904 ATTTATTTGCTGCTGGAGGCTGG - Exonic
1103213439 12:119183318-119183340 ATTTCTTGGCTGGTGGTTGCAGG - Intronic
1103526495 12:121572627-121572649 ATGTCTTTTCTGATGGTGACAGG - Intronic
1105423278 13:20272036-20272058 ATCTCTGTGCTGGAGATGGCAGG + Intergenic
1106023899 13:25939765-25939787 GTTTCAGTGGGGATGGTGGCAGG - Intronic
1106116480 13:26821885-26821907 ATCACTGTGCTGAAGTTGGCTGG + Intergenic
1106614895 13:31317261-31317283 ATTTGTGTGGTGAGAGTGGCAGG - Intronic
1107226382 13:38053645-38053667 ATTTCTGTGTTGATGCTCACAGG + Intergenic
1107336458 13:39361005-39361027 ATTCTTGTGTTGATGATGGCCGG - Intronic
1109330994 13:60929604-60929626 AATTCTTTGTTGAGGGTGGCAGG + Intergenic
1111531604 13:89543517-89543539 ATTTCTGTCCTGCTGCTTGCAGG - Intergenic
1111644985 13:91021521-91021543 GTGTCTGTGGTGATGGTGGTGGG - Intergenic
1111797093 13:92935722-92935744 ATGTCTGTGGTGATGGTCACAGG - Intergenic
1112958141 13:105087030-105087052 TTTTTTGTGCTGGTGGAGGCAGG + Intergenic
1113427270 13:110218990-110219012 ATGTCTCTTCTGATGGTGGTTGG - Intronic
1114374831 14:22133010-22133032 ACTTCTGTGCTGTGGGTGACAGG + Intergenic
1114992303 14:28301453-28301475 TTTGCTGTGCTGCAGGTGGCAGG + Intergenic
1116117283 14:40671062-40671084 ATTTCTGAGCAGTTGGTAGCAGG - Intergenic
1117601894 14:57384747-57384769 GTGTCTGTGCTGATGGTCCCTGG - Intergenic
1118105236 14:62651189-62651211 ATTTCACTGCTCAGGGTGGCTGG + Intergenic
1119154075 14:72392464-72392486 ATGTCTGTGATGATGGGAGCCGG - Intronic
1120734353 14:88036632-88036654 ATTTCAGTGCTGAGGGTGAATGG + Intergenic
1120799102 14:88669389-88669411 ATTTCTCCTCTGATGGTGCCTGG + Intronic
1122557228 14:102587707-102587729 ATTTTGCTGCAGATGGTGGCAGG - Intergenic
1122968590 14:105143373-105143395 ACTTCTGTGTTCCTGGTGGCTGG + Intronic
1123491099 15:20783437-20783459 CTGTCCGTGCTGCTGGTGGCGGG - Intergenic
1123547601 15:21352528-21352550 CTGTCCGTGCTGCTGGTGGCGGG - Intergenic
1123793980 15:23753347-23753369 ACTTCTGTGCTGCTGGAGGCTGG - Intergenic
1127913984 15:63440470-63440492 CTTTCTGGGCTGGTGGTGGGTGG - Intergenic
1128602303 15:69007508-69007530 ATTGCTGTGAAGATGGTGCCTGG + Intronic
1131207790 15:90466110-90466132 ATTTCTGTTTTGGTGGAGGCTGG + Intronic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1131962774 15:97807075-97807097 GTTTCTGTGCAGATGGGGGTGGG - Intergenic
1202955931 15_KI270727v1_random:79758-79780 CTGTCCGTGCTGCTGGTGGCGGG - Intergenic
1132502471 16:290611-290633 CTTTATGTGCTCAAGGTGGCAGG - Intronic
1132930553 16:2456872-2456894 CTTCCTGGCCTGATGGTGGCAGG - Exonic
1132974238 16:2703529-2703551 AGTCCTGGGCTGCTGGTGGCCGG - Intronic
1134555494 16:15160456-15160478 AATTCTCTGGGGATGGTGGCAGG - Intergenic
1135067600 16:19323651-19323673 TTTTCTGTGCTGGGGGAGGCCGG - Intergenic
1135587690 16:23683408-23683430 ATGTCTGTCCTTATGGTGACAGG - Intronic
1140725666 16:77809338-77809360 ATTTCTCTGATGATGGAGGATGG - Intronic
1141438137 16:84012613-84012635 ACTGCTGTGATGATGGTGTCTGG + Intronic
1143447415 17:7017673-7017695 ATTTCTGTGCTGCTAGAGCCAGG + Intergenic
1144078950 17:11744827-11744849 AAGTCCGTGCTGGTGGTGGCAGG + Exonic
1146228396 17:31087840-31087862 AGATCTGTGCTGTTGCTGGCAGG + Intergenic
1148232273 17:45943949-45943971 ACTTCTGCCCTGATGGTGGTGGG - Intronic
1150215212 17:63464129-63464151 ATTTCTTTGGTGGTGGTGGGGGG - Intergenic
1152134275 17:78494768-78494790 AAGTCTGTGCTGGTGGTGGCCGG - Exonic
1152252013 17:79217198-79217220 ATTTCTGTGCTCATTGTGAAGGG - Intronic
1152530218 17:80914323-80914345 ATCTCTGTGCTCTTGGGGGCCGG + Intronic
1152610628 17:81313563-81313585 AGTTCTCTCCTGACGGTGGCAGG - Exonic
1152762792 17:82118186-82118208 ACTTCTGTTCTGAGGGTGGCTGG + Intronic
1152855884 17:82664290-82664312 GGTGCTGTGCTGATGGTGGTGGG + Intronic
1153479298 18:5530848-5530870 ATGTCTGTGCTCAGGGTGACAGG + Intronic
1154292097 18:13117217-13117239 ATTTCTGGGCGGATGGGGGCAGG - Intronic
1155459966 18:26067851-26067873 ATTTTTCCACTGATGGTGGCCGG + Intronic
1156911701 18:42417970-42417992 ATTTCTATACTGATAGGGGCAGG - Intergenic
1157436329 18:47672619-47672641 ATTCCTGTGCTGATGGAGATGGG + Intergenic
1157710777 18:49848306-49848328 ATGTGGGTGCTGATGGTGGTGGG + Intronic
1160119227 18:76112598-76112620 ATTTATGTGATTATGGGGGCTGG - Intergenic
1160292799 18:77609421-77609443 ATTTCTGGGCAGAAGGGGGCGGG + Intergenic
1160633323 18:80262553-80262575 GTCGCTGGGCTGATGGTGGCGGG - Intergenic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1164952934 19:32353958-32353980 TTTTCTGTGCTGATGTAAGCAGG - Exonic
1164986429 19:32652011-32652033 ATTGCTGTGGGGATGGTGGGTGG - Intronic
1166175292 19:41064300-41064322 ATGTGTGTGGTGATGGTGGTTGG + Intergenic
925369306 2:3332535-3332557 ATGGCTGTGGGGATGGTGGCAGG - Intronic
925655679 2:6145729-6145751 ATGACTGTGGTGATGGTCGCAGG - Intergenic
926498566 2:13622196-13622218 ATTTCTGTGGTGATTATTGCTGG - Intergenic
926639334 2:15218902-15218924 CTTTCTGTGCTGATGACGCCTGG - Exonic
927452723 2:23222814-23222836 ATTATTGTGCTCATGGTGTCTGG - Intergenic
929791111 2:45023807-45023829 ATTTCTGTGTTCATTATGGCTGG - Intergenic
932388611 2:71362910-71362932 ACTTCTGTGCATATGCTGGCCGG + Intronic
932598574 2:73109313-73109335 TTTTGTGTGATGGTGGTGGCTGG - Intronic
933720931 2:85397234-85397256 ATGTCTGTGCTGCTGGTTCCAGG - Intronic
935107781 2:100061820-100061842 ATCTCTTTGGTGATGGTGGAGGG - Intronic
935963179 2:108447487-108447509 TTTTCTGAGATGATGGAGGCAGG - Intergenic
936469228 2:112783794-112783816 CTGGCTGAGCTGATGGTGGCTGG - Intronic
936766752 2:115859372-115859394 GCTTGTGTGCTGATGGTGGCAGG + Intergenic
937458164 2:122062064-122062086 CTTTTTGTGCTGATGGTGTCTGG + Intergenic
939474267 2:142666323-142666345 ATCCCTGTGCTGATGGTGATAGG + Intergenic
940976907 2:159956544-159956566 ATTTCTGTGCTGAAGAAGGGGGG - Exonic
941774256 2:169374706-169374728 ATTCTTGAGCTGATGGTGGGAGG + Intergenic
943317298 2:186405855-186405877 ATTTGTGTGCTAATGGGGGATGG - Intergenic
943830234 2:192451716-192451738 ATTCCTGTCCTGATTGTGGTAGG + Intergenic
948180623 2:235977127-235977149 AGTTCTCTGCTGATGGACGCCGG - Intronic
948751275 2:240134778-240134800 CTTACTGTGCTGATGGGGACAGG - Intronic
1170697378 20:18671412-18671434 TGTTCTGTGCTGATGGAGACGGG - Intronic
1170858503 20:20080335-20080357 CTTTCTTTTCTGATGGTGCCTGG + Intronic
1173250951 20:41364002-41364024 TTTTCTGTGCTTAAGGTGACAGG + Intronic
1175430429 20:58898315-58898337 TTTTCTGTGGTGGTGGTGGGTGG + Intronic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1178132725 21:29591413-29591435 ATATCTGTGCTATTGGGGGCAGG + Intronic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1179633324 21:42691985-42692007 AGTGATGTGCTGATGGTGACAGG - Intronic
1184189179 22:42883661-42883683 ATTTCTGGGCTGGTCGTGCCTGG - Intronic
1184807835 22:46807305-46807327 ATAACTGTGATGATGGTGGTGGG + Intronic
1185004546 22:48268035-48268057 TTTGCTGTCCTGCTGGTGGCAGG - Intergenic
950575522 3:13829982-13830004 ATGTCTGTGCTGCTGCTGCCTGG + Intronic
951038986 3:17967372-17967394 ACTTCTGTTCTGTTTGTGGCTGG + Intronic
951250555 3:20389454-20389476 ACTTCTGTGTGGATGGTGGTGGG + Intergenic
953079421 3:39601700-39601722 TTTCCTGGGCTCATGGTGGCAGG - Intergenic
954673111 3:52301160-52301182 ATGTTTGTGGAGATGGTGGCAGG + Intergenic
955219440 3:57011569-57011591 AATTCTTTGCTGTGGGTGGCGGG - Intronic
956110577 3:65866531-65866553 CTTTCTGTGCTGGTGGGAGCAGG - Intronic
957469370 3:80638517-80638539 ATTTCTCTGAAGCTGGTGGCAGG - Intergenic
959038138 3:101388258-101388280 ATACCTGTGGTGGTGGTGGCAGG - Intronic
959901232 3:111663895-111663917 ATTTCTGGGCGTGTGGTGGCAGG - Intronic
960474821 3:118110841-118110863 ATTTGTGTGCTAAAGGTGGGTGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961462352 3:127059382-127059404 ATTTATGTACAGATGGTTGCAGG + Intergenic
962204100 3:133421035-133421057 ATTGCTGTGGGGATGCTGGCTGG + Intronic
962733217 3:138301765-138301787 ATTTCTTTGTGGATGGTGGGTGG - Intronic
963861156 3:150312001-150312023 TTTTCTCTTCTGATTGTGGCAGG + Intergenic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
964781036 3:160338288-160338310 TTTTCTGTGCAGTTGGTGCCAGG - Intronic
964791837 3:160460317-160460339 ATTCCTGGGCTGAAGGGGGCGGG - Intronic
965224452 3:165971050-165971072 ATTTCTGTGGTGATGTGGGTTGG + Intergenic
966863736 3:184244792-184244814 GTTGCTGTGGTGATGGTGGGGGG - Intronic
967097440 3:186188509-186188531 ATTTCTCTTCTGACAGTGGCAGG - Intronic
967131522 3:186475518-186475540 ATATTTGTGCTGATGGTGCAGGG + Intergenic
967385983 3:188911409-188911431 ACTTCTGGGCTGATGGCAGCAGG + Intergenic
968740916 4:2331271-2331293 AGGTCTGTGCTGATGGGGACTGG + Intronic
968955996 4:3719920-3719942 TTTTGTGAGCTGGTGGTGGCAGG - Intergenic
971988677 4:33863287-33863309 TTTTCAGTGCCTATGGTGGCAGG - Intergenic
972421679 4:38893501-38893523 ATTTCTGTGTTTACTGTGGCAGG - Intronic
972728087 4:41764054-41764076 ATCTCTGTCTTGATGATGGCAGG - Intergenic
973200820 4:47500202-47500224 ATTTCTACGCTGATGGAGGAGGG + Intronic
973892529 4:55381734-55381756 GTTGCAGTGGTGATGGTGGCGGG + Intergenic
973985546 4:56348746-56348768 AGTTCTTTGCTGATTCTGGCAGG - Intronic
977487425 4:97666094-97666116 ATTCCTGTGCTCTTGGGGGCTGG - Intronic
978498391 4:109384247-109384269 ATTTCTGAGCCTATGGGGGCAGG - Intergenic
980841074 4:138262161-138262183 ATTTCAGTGCCAGTGGTGGCTGG - Intergenic
980877427 4:138676174-138676196 ATTTATGTGCTGAGGTTGGGTGG - Intergenic
981227958 4:142318987-142319009 ATTGCTGTCCTGAGGGTGGGAGG + Intronic
987397738 5:17441495-17441517 ACTTCTGTACTGATGCTTGCAGG - Intergenic
989829396 5:45895728-45895750 ATTTATTTGATGCTGGTGGCTGG - Intergenic
990432544 5:55750676-55750698 CCTTCTGTGCTGATGCTGCCCGG - Intronic
993947450 5:94132675-94132697 AATTCTCTGCACATGGTGGCGGG - Intergenic
996337751 5:122403328-122403350 ATGTCTGTGCCGATGCTGACTGG - Intronic
996659867 5:125988997-125989019 CTTTCCGTGCTGCTGGGGGCTGG + Intergenic
999122909 5:149223678-149223700 CTCTCTGTACTGATGGTGGCAGG - Intronic
1002807868 6:595108-595130 ATTTCTATCTTGATGTTGGCAGG - Intronic
1003616365 6:7658584-7658606 GTCTCTGTGCTGCTGCTGGCAGG + Intergenic
1004474384 6:15957600-15957622 ACTTCTTTGCTGCTGGTGCCTGG - Intergenic
1005451179 6:25974234-25974256 ATTTCTTTCCTGATGGTTGCAGG + Intronic
1006955930 6:37871910-37871932 ATTTAGCTGCTGATGGTGGTGGG - Intronic
1008736479 6:54550431-54550453 ACTTCTGGCCAGATGGTGGCAGG + Intergenic
1013431702 6:110062017-110062039 ATCCCTGGGCTGGTGGTGGCTGG - Intergenic
1014539085 6:122652364-122652386 ATTTATGTGATTATGGAGGCTGG + Intronic
1016837509 6:148493210-148493232 ACTTCAGTGGTGATGGTGGTGGG - Intronic
1017112089 6:150941600-150941622 ATTTGTTTGCTGATGTTTGCAGG + Intronic
1017602464 6:156098571-156098593 ATTGCTGTGATGATGGTGATGGG - Intergenic
1018192848 6:161325741-161325763 ATGTCTGTAGTGATGATGGCTGG + Intergenic
1018455961 6:163952341-163952363 CTTTCTGTGCTGCTGCTGGAAGG - Intergenic
1021880462 7:25090469-25090491 ACTTCTGTGCTTATGGTTGTTGG - Intergenic
1022502663 7:30892440-30892462 CTGTCTGTGCTGATCATGGCTGG + Intergenic
1022727044 7:32990753-32990775 ATTCTTTTGCTGATGGAGGCTGG + Intronic
1023618698 7:42047883-42047905 ATGTCAGTGCTGTTGGTGCCTGG - Intronic
1025046536 7:55696877-55696899 ATTCTTTTGCTGATGGAGGCTGG - Intergenic
1027468745 7:78547557-78547579 ATTTCAGGGCTGAGGATGGCTGG + Intronic
1027580785 7:79992714-79992736 ATATCTGTGCTGATGCTGTCAGG - Intergenic
1033851602 7:145502960-145502982 GTTTCTGTTCTTATGGTTGCGGG - Intergenic
1034337793 7:150334577-150334599 ATCTCCCTGCTGATGGTGCCTGG + Intronic
1034458717 7:151186464-151186486 GTTCATGTGCTGCTGGTGGCAGG - Exonic
1035117877 7:156540024-156540046 AGTTCAGTGGTGATGGTGGGGGG - Intergenic
1036136103 8:6162994-6163016 ATGTCTGTGCTAAGGGTGGGTGG + Intergenic
1036777486 8:11623620-11623642 ATGTCTGTGATGATGGAGGCAGG - Intergenic
1037483782 8:19328696-19328718 ATTTCTGAGCAGATGGTGCAAGG - Intronic
1039034685 8:33347109-33347131 GTTTTTGTGCGGATGGTGACAGG - Intergenic
1040014398 8:42689437-42689459 ATTTCTGTGCTGGTCAAGGCCGG + Intergenic
1041637146 8:60156707-60156729 GTTTTTGTGCTGGTGCTGGCTGG - Intergenic
1041875683 8:62684235-62684257 ATTTCTGTGCTGGTGGAGTAGGG - Intronic
1042727464 8:71893546-71893568 GTGTCAGTGCTGATGGTGACAGG + Intronic
1043391284 8:79794736-79794758 CTTTCTGTACTGAGGCTGGCTGG - Intergenic
1045980730 8:108184399-108184421 ATTTCAGTGCTGTTGGGAGCAGG + Intergenic
1047368344 8:124233396-124233418 TATTCTGTGCTGATTCTGGCTGG + Intergenic
1050808464 9:9714718-9714740 AGTTCTCTGCTGATGGTGGGAGG + Intronic
1053358079 9:37464097-37464119 ATTTCTGTGGGGACGGTGGTTGG - Intronic
1053393986 9:37755650-37755672 ATTACTCTTCTGATGGTGGTTGG + Intronic
1054340776 9:63859804-63859826 GCTTCGGTGCTGACGGTGGCGGG + Intergenic
1055020917 9:71668743-71668765 ATTTCTGTGTTTCTGGTGCCTGG - Intergenic
1056643754 9:88392405-88392427 AATTCTGTGCTGAAGGTATCTGG + Intronic
1056789923 9:89618625-89618647 ACTTCTGTTCTGATGATGGATGG - Intergenic
1056881923 9:90402730-90402752 ATTTCTTTCCTTTTGGTGGCTGG - Intergenic
1056908091 9:90671934-90671956 ATTTCTGTACTCACGGTGGAAGG - Intergenic
1059238588 9:112783772-112783794 GTTTCTGTGCTGAGGGCTGCTGG + Intronic
1203784723 EBV:121253-121275 ACCTCTGTGTTGCTGGTGGCTGG + Intergenic
1186224713 X:7386381-7386403 TTTCCTCTGCTGATGGGGGCAGG + Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1186556026 X:10559717-10559739 CTTTCTCTGTTGATGGTGGCAGG - Intronic
1189600175 X:42615677-42615699 AACTTTGTGCTGTTGGTGGCGGG - Intergenic
1190148071 X:47916307-47916329 ATGTTTGTGCTGATTGTGGGAGG + Exonic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1190291072 X:48992660-48992682 ACTTCTGTGGTGATGGATGCTGG - Intronic
1190442957 X:50494136-50494158 ATTTCTGTGCAGATTCTGTCTGG + Intergenic
1192177320 X:68894267-68894289 CTTCCTGGGCTGGTGGTGGCGGG + Intergenic
1192508502 X:71706940-71706962 TTTTGTCTGCTTATGGTGGCAGG + Intergenic
1192512145 X:71727776-71727798 TTTTGTCTGCTTATGGTGGCAGG - Intergenic
1192514552 X:71753729-71753751 TTTTGTCTGCTTATGGTGGCAGG + Intergenic
1192518195 X:71774613-71774635 TTTTGTCTGCTTATGGTGGCAGG - Intergenic
1192637431 X:72832625-72832647 ATTTCTGTGGTGGTGGGGGTTGG + Intronic
1192644283 X:72888189-72888211 ATTTCTGTGGTGGTGGGGGTTGG - Intronic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1199305700 X:146265222-146265244 ATTTCAGTGCAGCTGATGGCTGG - Intergenic
1200314730 X:155119896-155119918 CTTTCTGTGCTCATGGTTGGGGG + Intronic
1200781859 Y:7223917-7223939 ATTTGTGTGCCAATGTTGGCTGG - Intergenic
1202377955 Y:24255392-24255414 CGCTCTGTGCTGATGGAGGCTGG - Intergenic
1202492827 Y:25414729-25414751 CGCTCTGTGCTGATGGAGGCTGG + Intergenic