ID: 1070813852

View in Genome Browser
Species Human (GRCh38)
Location 10:79311454-79311476
Sequence TGCTGCGCAAGGGACCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070813852_1070813858 5 Left 1070813852 10:79311454-79311476 CCTGCGGGGTCCCTTGCGCAGCA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1070813858 10:79311482-79311504 GGGTCCCTGCCCTCCCCCGATGG No data
1070813852_1070813863 16 Left 1070813852 10:79311454-79311476 CCTGCGGGGTCCCTTGCGCAGCA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1070813863 10:79311493-79311515 CTCCCCCGATGGTGAGCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070813852 Original CRISPR TGCTGCGCAAGGGACCCCGC AGG (reversed) Intronic
900293759 1:1937882-1937904 TGCTGTGCAGGGCACCCCTCTGG - Intronic
900645995 1:3708959-3708981 TGCTGAGCAAGGGGCCCCTCAGG + Intronic
903262514 1:22139065-22139087 TGCTCAACAAGGGCCCCCGCAGG - Intronic
905521771 1:38605798-38605820 TGCTTCCCAAGGGAGGCCGCTGG + Intergenic
906020918 1:42628552-42628574 TGTTGTGCAAGGGACCCAGGGGG + Intronic
907483767 1:54762554-54762576 TGCTGGTCCAGGGACCCCACTGG + Intronic
907523440 1:55039910-55039932 TCCTGCGCACGGGCGCCCGCGGG - Exonic
908919392 1:69171049-69171071 TGTTGCGGAAGGGACCCAGTGGG + Intergenic
911953625 1:104208971-104208993 TGTTGTGCAAGGGACCCAGTGGG - Intergenic
912798718 1:112707504-112707526 TGCTGCACCTGGGACCTCGCGGG + Intronic
918883468 1:190158105-190158127 TGTTGTGGAAGGGACCCCGTGGG + Intronic
923197740 1:231684563-231684585 TGATGTGCAAGGGACCTCGAGGG - Intronic
1063429692 10:5977680-5977702 TGCTGGGGAAGGAGCCCCGCCGG + Intronic
1070813852 10:79311454-79311476 TGCTGCGCAAGGGACCCCGCAGG - Intronic
1075721415 10:124589784-124589806 TGCGGCACCAGGGACCCTGCAGG - Intronic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1080321071 11:31010003-31010025 TGTTGGGCAAGGGACCCAGTGGG - Intronic
1080768750 11:35321218-35321240 TGTTGTGGAAGGGACCCCGTGGG - Intronic
1082766052 11:57168923-57168945 TGTTGTGGAAGGGACCCAGCAGG - Intergenic
1083364518 11:62133437-62133459 TGCTGCCCGATGGGCCCCGCAGG - Intronic
1086613239 11:88782495-88782517 TGTTGTGGAAGGGACCCCGTGGG - Intronic
1088861401 11:113803206-113803228 TGCTGATGAAGGGGCCCCGCCGG - Exonic
1096113278 12:49041144-49041166 GGCTGCGCAGGGGCCCCCGTAGG + Exonic
1096814491 12:54193347-54193369 GGCTGAGCCAGGGACCCCACTGG - Intergenic
1098605727 12:72387677-72387699 TGTTGTGCAAGGGACCCAGTGGG + Intronic
1108050120 13:46426748-46426770 TGTTGTGGAAGGGACCCAGCGGG + Intronic
1109542640 13:63800057-63800079 TGTTGTGGAAGGGACCCAGCGGG + Intergenic
1112307287 13:98286392-98286414 TGTTGTGCAAGGGACCCCATGGG + Intronic
1113341528 13:109430747-109430769 GGCTGAGCAAGGGCCCCAGCTGG - Intergenic
1113668050 13:112154474-112154496 AGCTGTGCTTGGGACCCCGCCGG - Intergenic
1115113802 14:29855705-29855727 TGCTGTGGAAGGGACCCAGTGGG + Intronic
1117012093 14:51481470-51481492 TGTTGCGGAAGGGACCCAGTGGG - Intergenic
1117613166 14:57504753-57504775 TGCTGCCCTGGGGACCCCGAGGG + Intergenic
1118140805 14:63080002-63080024 TGTTGTGCAAGGGACCCAGTGGG + Intronic
1202848793 14_GL000225v1_random:2475-2497 TGATGTGCAAGGGAGCCAGCTGG + Intergenic
1202852909 14_GL000225v1_random:31942-31964 TGATGTGCAAGGGAGCCCGCTGG + Intergenic
1202857870 14_GL000225v1_random:63034-63056 TGACGTGCAAGGGAGCCCGCTGG - Intergenic
1202863919 14_GL000225v1_random:103669-103691 TGATGTGCAAGGGAGCCCGCTGG - Intergenic
1123799872 15:23808649-23808671 TGCTGTGGAATGGACCCTGCTGG + Intergenic
1126299997 15:47184598-47184620 TGCTGCGCACGGGAACCGGGCGG - Intronic
1127770119 15:62224247-62224269 GGCGGCGCCAGGGGCCCCGCTGG + Intergenic
1128989305 15:72245424-72245446 TGTTGTGGAAGGGACCCAGCGGG - Intronic
1130955818 15:88626559-88626581 TGGTGGGCACGGGACCCCGAGGG + Exonic
1131119838 15:89815069-89815091 TGCGGCGACAGGGACCCCGTCGG - Intronic
1132870903 16:2115382-2115404 TACTGCGCGGGGGGCCCCGCGGG + Exonic
1133193577 16:4152384-4152406 TGCTGAAGAAGGGACCCTGCGGG + Intergenic
1133648712 16:7788926-7788948 TGTTGTGCAAGGGACCCCGTGGG + Intergenic
1134521622 16:14921501-14921523 TACTGCGCGGGGGGCCCCGCGGG - Intronic
1134709293 16:16320152-16320174 TACTGCGCGGGGGGCCCCGCGGG - Intergenic
1134716504 16:16360181-16360203 TACTGCGCGGGGGGCCCCGCGGG - Intergenic
1134950311 16:18348493-18348515 TACTGCGCGGGGGGCCCCGCGGG + Intergenic
1134958246 16:18391978-18392000 TACTGCGCGGGGGGCCCCGCGGG + Intergenic
1135040889 16:19115705-19115727 TGCTGCGCAAGGGGGCCCCTGGG + Exonic
1138338323 16:56270029-56270051 TGCTGCCTTAGGGACCCTGCAGG - Intronic
1139517655 16:67461251-67461273 TGCTGCACAAGGTCCCCTGCAGG - Intronic
1142200618 16:88759606-88759628 TGCTCTGCAAGGGAGCCTGCTGG + Intronic
1142840475 17:2624643-2624665 TGTTACGGAAGGGACCCAGCGGG - Intronic
1143122417 17:4617115-4617137 AGCTGGGCCAGAGACCCCGCGGG + Intergenic
1144494365 17:15737228-15737250 TGCAGCCCAAGGCACCCCACGGG + Intronic
1144639694 17:16930626-16930648 TGCAGCCCAAGGCACCCCACAGG - Intronic
1144905900 17:18639448-18639470 TGCAGCCCAAGGCACCCCACGGG - Intronic
1146896332 17:36544807-36544829 GGCCGCGCTGGGGACCCCGCTGG - Intergenic
1148139797 17:45320161-45320183 TGTTGTGCAAGGGACCCAGTGGG - Intergenic
1152587884 17:81197159-81197181 TGCTGCACACGGGAGCCCGTGGG + Intronic
1152628933 17:81400922-81400944 GGCTGCGCTAGGGACCCGCCGGG + Intronic
1152885271 17:82845649-82845671 TGCTGCGGAAGGGACCGGGGTGG - Intronic
1153382679 18:4455651-4455673 TGCTGCGCAAGGGAACCAATGGG - Intergenic
1158313264 18:56182288-56182310 TGCTGTGGGAGGGACCCAGCGGG - Intergenic
1161401437 19:4067492-4067514 TGCCGCGCCAGGGACCCCGGGGG + Intergenic
1161647333 19:5461619-5461641 TGTTGGGCAAGGGACCCCATAGG - Intergenic
1162778958 19:12996649-12996671 TGCTGCGGAGTGGACCCGGCAGG + Intronic
1166686674 19:44800563-44800585 TGCTGCTCAAGGGAGCCCCAAGG + Exonic
925118963 2:1402763-1402785 TGCTGTGGGAGGGACCCAGCGGG - Intronic
925453503 2:3991829-3991851 TGCTGTGCAAGGGACCTGGTGGG - Intergenic
929113863 2:38428180-38428202 TGCTGCTCCAGGGACCTCACTGG - Intergenic
936450498 2:112630429-112630451 AGCTGCGGAAGGGACCCAGAAGG - Intergenic
937313430 2:120916071-120916093 TGCTGCTCCAGGGACCACCCCGG - Intronic
947714694 2:232333655-232333677 TGCTGCACAAGGGGCCCCAGGGG - Intronic
1170832070 20:19851239-19851261 TGCTGGGGAAGGGACCCCAGTGG + Intergenic
1175068599 20:56312221-56312243 TGCTGTGGAAGGGACCCGGTGGG + Intergenic
1175192330 20:57219749-57219771 TGCTGCGCAGAGCACCCCGAAGG - Intronic
1175531945 20:59679862-59679884 TGTTGCGGGAGGGACCCAGCAGG - Intronic
1175881738 20:62263257-62263279 CGCTGCCCCAGGGACCCAGCAGG + Intronic
1180413963 22:12692792-12692814 TGACGTGCAAGGGAGCCCGCTGG - Intergenic
1182081699 22:27533919-27533941 TGCTGCCCCAGGGAACCCGCAGG - Intergenic
1182374705 22:29838128-29838150 TGCAGGGCAAGGGACCCCGGAGG - Intronic
1185281463 22:49971756-49971778 TCCTGCCCCAGGGACCCTGCCGG - Intergenic
950425904 3:12924640-12924662 TGCAGCGCAAGGGCCTCAGCCGG - Exonic
961530333 3:127536548-127536570 AGATGCCCAAGGGACCCCCCAGG - Intergenic
962644573 3:137423754-137423776 TGCTGTGGAAGGGACCCAGTGGG + Intergenic
966876717 3:184326467-184326489 TGCTGGCCAAGGGACTCAGCCGG + Intronic
968733160 4:2281199-2281221 TACTGCCCAAGGGAACCGGCTGG + Intronic
970707882 4:18826763-18826785 TGCTGTGCAAGGGACCCGGTGGG - Intergenic
974214659 4:58829198-58829220 TGCTGTGGAAGGGACCCAGTAGG - Intergenic
982494307 4:156071202-156071224 TGCTGTGGAAGGGACCCAGTGGG - Intergenic
983068263 4:163236867-163236889 TGTTGTGGAAGGGACCCAGCAGG - Intergenic
983105644 4:163682626-163682648 TGCTGTGGAAGGGACCCAGTGGG + Intronic
985718038 5:1473628-1473650 TGGTGAGCAGGGGACCCTGCAGG + Intronic
986081238 5:4396249-4396271 TGTTGTGCAAGGGACCCAGTGGG - Intergenic
987332879 5:16872879-16872901 TGCTGTGGAAGGGACCCAGAGGG - Intronic
994961345 5:106607865-106607887 TGCTGTGGAAGGGACCCAGAAGG + Intergenic
999419378 5:151427714-151427736 TGCTGCACAGGGGTCCCCACTGG - Intergenic
1002073195 5:176692833-176692855 TCCTGAGCAGGGGACCCCTCGGG + Intergenic
1003101004 6:3176484-3176506 TGCTGCACAAGTGACCCCTGGGG + Intergenic
1017882896 6:158573812-158573834 TGCTGTGCACGAGACCCAGCTGG + Intronic
1018046400 6:159969564-159969586 GCCTGCGCACGGGACCCGGCGGG - Intronic
1018730492 6:166646522-166646544 TGCAGCGCAAGGGCCCCGCCAGG + Intronic
1019425605 7:975249-975271 TGCTGCGGCATGGACCCTGCAGG - Intronic
1020072018 7:5233365-5233387 TGCTGCGCCAGTGACCCAGGTGG + Exonic
1023123769 7:36935100-36935122 TGCTGTGGAAGGGACCCAGTGGG + Intronic
1034194686 7:149237407-149237429 TGCTGGGCTAGGGACCCAGACGG + Intergenic
1038008673 8:23457201-23457223 TGCTGCACCCGGGACCCAGCCGG - Intronic
1039588911 8:38730221-38730243 TTCTGCCCTAGGGAACCCGCTGG + Intronic
1042922926 8:73938216-73938238 TGTTGCGGAAGGGACCCAGTGGG + Intergenic
1049010963 8:139887095-139887117 GGCTGCCCAAGAGAGCCCGCCGG + Intronic
1051940607 9:22501281-22501303 TGCGGAGGGAGGGACCCCGCGGG - Intergenic
1056467158 9:86868878-86868900 TGCTGCCCAAGAGACACCACAGG + Intergenic
1059048564 9:110897192-110897214 TGTTGCGGAAGGGACCCCATGGG + Intronic
1062382743 9:136295245-136295267 TGCTGGGCCAGGGACCCGCCTGG + Intronic
1062555660 9:137112497-137112519 TGCTGCCCAAGGGGCCCCTGGGG - Intronic
1062598004 9:137307703-137307725 GGCTGCGTCATGGACCCCGCTGG - Intronic
1203740400 Un_GL000216v2:172347-172369 TGATGTGCAAGGGAGCCCGCTGG + Intergenic
1188196530 X:27241210-27241232 TGTTGTGGAAGGGACCCCGTGGG + Intergenic
1193014414 X:76716220-76716242 TGTTGTGGAAGGGACCCCGTGGG + Intergenic
1196133483 X:112182001-112182023 TGCTGTTCTAGAGACCCCGCTGG + Intergenic
1199991218 X:152988690-152988712 TGCAGCCCAAGGCACCCCACAGG + Intergenic
1200090329 X:153632982-153633004 TTCTGCTCCAGGGAGCCCGCTGG - Intergenic
1201176085 Y:11308793-11308815 TGACGTGCAAGGGAGCCCGCTGG + Intergenic