ID: 1070814226

View in Genome Browser
Species Human (GRCh38)
Location 10:79312967-79312989
Sequence CCACCTCCACACCCTTGGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070814216_1070814226 18 Left 1070814216 10:79312926-79312948 CCAGTGCACCAGGAAGGCTGTGT 0: 1
1: 0
2: 1
3: 22
4: 208
Right 1070814226 10:79312967-79312989 CCACCTCCACACCCTTGGCTTGG 0: 1
1: 0
2: 0
3: 38
4: 371
1070814219_1070814226 10 Left 1070814219 10:79312934-79312956 CCAGGAAGGCTGTGTGGGTCTGG 0: 1
1: 0
2: 5
3: 51
4: 360
Right 1070814226 10:79312967-79312989 CCACCTCCACACCCTTGGCTTGG 0: 1
1: 0
2: 0
3: 38
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070814226 Original CRISPR CCACCTCCACACCCTTGGCT TGG Exonic