ID: 1070815063

View in Genome Browser
Species Human (GRCh38)
Location 10:79317678-79317700
Sequence TGTGCCTTAGAGCAGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070815054_1070815063 1 Left 1070815054 10:79317654-79317676 CCGTAGGAGACATGCCCCCCTCC No data
Right 1070815063 10:79317678-79317700 TGTGCCTTAGAGCAGTGTGGTGG No data
1070815053_1070815063 2 Left 1070815053 10:79317653-79317675 CCCGTAGGAGACATGCCCCCCTC No data
Right 1070815063 10:79317678-79317700 TGTGCCTTAGAGCAGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070815063 Original CRISPR TGTGCCTTAGAGCAGTGTGG TGG Intergenic
No off target data available for this crispr