ID: 1070817214

View in Genome Browser
Species Human (GRCh38)
Location 10:79332082-79332104
Sequence GGAGAGATAATGCACCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070817211_1070817214 -3 Left 1070817211 10:79332062-79332084 CCAAGCCTCTTGGAAGGGGAGGA No data
Right 1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG No data
1070817204_1070817214 29 Left 1070817204 10:79332030-79332052 CCCGTGAGATGTATTATGCTGTG No data
Right 1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG No data
1070817212_1070817214 -8 Left 1070817212 10:79332067-79332089 CCTCTTGGAAGGGGAGGAGAGAT No data
Right 1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG No data
1070817205_1070817214 28 Left 1070817205 10:79332031-79332053 CCGTGAGATGTATTATGCTGTGT No data
Right 1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070817214 Original CRISPR GGAGAGATAATGCACCTTCT GGG Intergenic
No off target data available for this crispr