ID: 1070820047

View in Genome Browser
Species Human (GRCh38)
Location 10:79349132-79349154
Sequence AGATGGGTCTAGAGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 413}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070820040_1070820047 -9 Left 1070820040 10:79349118-79349140 CCTGGGGCCTTCTGAGATGGGTC 0: 1
1: 0
2: 2
3: 25
4: 263
Right 1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 413
1070820032_1070820047 15 Left 1070820032 10:79349094-79349116 CCAAAGACAGCTGGTAAGACAGG 0: 1
1: 0
2: 0
3: 19
4: 219
Right 1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 413
1070820031_1070820047 16 Left 1070820031 10:79349093-79349115 CCCAAAGACAGCTGGTAAGACAG 0: 1
1: 0
2: 0
3: 15
4: 213
Right 1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070820047 Original CRISPR AGATGGGTCTAGAGGGAAGG GGG Intronic
900291996 1:1927560-1927582 AGAGGGGCCTGGAGGGAAGCAGG + Intronic
900312507 1:2040972-2040994 AGCTGGGTGTGGAGGGAAAGGGG - Intergenic
900522133 1:3110921-3110943 GGATGGGTCTAAATCGAAGGAGG + Intronic
900563045 1:3317527-3317549 AGTGGGGTCTGGATGGAAGGAGG - Intronic
900741477 1:4333209-4333231 GGCTGGGTCTCTAGGGAAGGGGG - Intergenic
900741508 1:4333298-4333320 GGCTGGGTCTCTAGGGAAGGGGG - Intergenic
901131181 1:6963132-6963154 AGCTGGGTCAAAATGGAAGGTGG - Intronic
901470097 1:9450097-9450119 AGATGGGGCCAGAAGGCAGGGGG + Intergenic
902404695 1:16176208-16176230 AGATAGGGAGAGAGGGAAGGGGG - Intergenic
902447778 1:16478135-16478157 AGAGGGGTCCAGATGGTAGGAGG + Intergenic
902467679 1:16628346-16628368 AGAGGGGTCCAGACGGTAGGAGG + Intergenic
904423624 1:30409717-30409739 GGAGGGCTCTAGTGGGAAGGAGG + Intergenic
904563932 1:31415935-31415957 AGATGGGTCCACAGGGGATGGGG + Intronic
904788209 1:32998359-32998381 AGATGGGGCTACAGGGCAGGTGG - Intergenic
904877090 1:33663507-33663529 AATTGGGGCTAGAGGGCAGGGGG + Intronic
905429174 1:37909277-37909299 AGATGGGTCTGTAGAAAAGGAGG - Intronic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
907471942 1:54679804-54679826 AGGTGGGAGGAGAGGGAAGGGGG - Intronic
908186537 1:61657784-61657806 TGGTGGGACTAGAGGGAAAGTGG + Intergenic
910993498 1:93079570-93079592 AGATGGGGGTTGGGGGAAGGAGG + Intronic
911512869 1:98828447-98828469 AGATGGGGCTTGATGGGAGGTGG + Intergenic
912084296 1:105980389-105980411 AGATGAGTCTAGAGATAGGGAGG + Intergenic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915236926 1:154490635-154490657 AGATGGGTCTAAAGGCCAGAAGG + Intronic
915367476 1:155324032-155324054 AGGTGGGTCTGGAGGGAGAGGGG - Intronic
915908867 1:159899987-159900009 AGTTGGGTCTAGGGGTCAGGAGG - Intronic
916595521 1:166238837-166238859 TCAGGGGTCTAGGGGGAAGGAGG - Intergenic
916658611 1:166900250-166900272 AGATGGCAATAGAGAGAAGGAGG - Intergenic
917623372 1:176820669-176820691 AGATGGGAAAAGAGGGTAGGAGG - Intronic
917728278 1:177848554-177848576 AGATGGGGCAGGAGGGAGGGAGG - Intergenic
917752659 1:178067608-178067630 AGCTGGGTCTAGAGTAAAGTAGG + Intergenic
918049920 1:180964981-180965003 AGATGGGGATATGGGGAAGGGGG - Intergenic
918116062 1:181498824-181498846 AGAAGGGACTAGAGAGAAGATGG - Intronic
918307764 1:183262838-183262860 AGATGGGGGAAGAGGGGAGGAGG + Intronic
919614185 1:199784982-199785004 AGGTGAGGCTAGAGAGAAGGTGG - Intergenic
920000775 1:202797137-202797159 AGATGGGGAAAGAGGGGAGGAGG + Intronic
920050868 1:203164086-203164108 AGATTGGTTTAAAGGGAAGTAGG + Intronic
920137022 1:203778242-203778264 GGGTGCTTCTAGAGGGAAGGAGG - Intergenic
920407986 1:205733802-205733824 AGATAGATATACAGGGAAGGAGG - Intronic
921048355 1:211493150-211493172 TGATGGATGAAGAGGGAAGGCGG - Intergenic
921080482 1:211735329-211735351 AGAAGCACCTAGAGGGAAGGAGG - Intergenic
921683278 1:218059876-218059898 AGCTGGGGGCAGAGGGAAGGAGG - Intergenic
921774270 1:219078952-219078974 GGATAGGGCTAGCGGGAAGGAGG + Intergenic
922095305 1:222438509-222438531 AGTTGGGTTGAGAGGGCAGGTGG - Intergenic
922664398 1:227456270-227456292 AGAAGGGACTAGAGAGAAGATGG - Intergenic
923327005 1:232888888-232888910 AGAAAGGAATAGAGGGAAGGAGG - Intergenic
1063113954 10:3060160-3060182 AGCAGGGTCTGGAGGGGAGGAGG + Intergenic
1063248508 10:4248933-4248955 AGATGGGTCTATAAGTAGGGAGG - Intergenic
1065856957 10:29838844-29838866 AGAGGGGTGAAGGGGGAAGGGGG + Intergenic
1067576746 10:47413948-47413970 AGGAGGCTCTAGAGGGCAGGAGG + Intergenic
1067576750 10:47413965-47413987 AGGAGGCTCTAGAGGGCAGGAGG + Intergenic
1067925141 10:50501089-50501111 ACATGGGATGAGAGGGAAGGAGG - Intronic
1069073030 10:64009740-64009762 AGAGGGTTCAAGAGAGAAGGGGG - Intergenic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1070825426 10:79387809-79387831 AGAAGGTTCTAGAAGGCAGGTGG + Intronic
1072436211 10:95416583-95416605 AGATAAATCTTGAGGGAAGGAGG - Intronic
1072637328 10:97186216-97186238 GGATGGGAGAAGAGGGAAGGGGG + Intronic
1072884422 10:99261213-99261235 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1073825599 10:107316996-107317018 AGATGAGTGTAGAGGGAGGTAGG + Intergenic
1075248606 10:120846499-120846521 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1077465951 11:2733736-2733758 AGAGGGGTCTAGCGGGCAGGAGG + Intronic
1078596079 11:12687916-12687938 AGGTGGGTGTAGTGGGTAGGGGG + Intronic
1080108746 11:28541498-28541520 AGATGAGACTAGAGGGGTGGTGG + Intergenic
1081765710 11:45608622-45608644 AGATGGGCCGTGAAGGAAGGGGG - Intergenic
1083294983 11:61710336-61710358 AGATGGGCTTAAAGGGAGGGGGG + Intronic
1083476913 11:62921062-62921084 GGAGGGGTCTAGAGGGCAAGGGG - Intronic
1084012543 11:66360678-66360700 TGCTGGGTCTACTGGGAAGGAGG + Intronic
1085570088 11:77551530-77551552 AGATGGGTCTGTAGAAAAGGAGG - Intronic
1087196820 11:95311179-95311201 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1088665447 11:112089267-112089289 AGATGGGGCAAGAGTGCAGGAGG - Intronic
1088984708 11:114895432-114895454 AGGTGGGTGAAGAGGGAAAGAGG - Intergenic
1089247471 11:117132759-117132781 AGAAAGGTCTAGAGTTAAGGAGG + Intergenic
1089472186 11:118730242-118730264 AGATGGGTCTGTAGAAAAGGAGG + Intergenic
1089922335 11:122221383-122221405 AGAGGGCTCTAGAGTGAGGGAGG - Intergenic
1089935414 11:122359364-122359386 AGAGGGGACTGGAGGGAGGGAGG - Intergenic
1090700138 11:129287009-129287031 CGAAGGCTCCAGAGGGAAGGAGG + Intergenic
1090828995 11:130408021-130408043 AGATGGATCTTCAGAGAAGGGGG - Intronic
1092004452 12:5057366-5057388 AGATGGGTGTGGAGGGATGGAGG + Intergenic
1092594442 12:9986019-9986041 AGCTGGGCCTAGAGGGAAGGGGG + Intronic
1092673757 12:10892423-10892445 AGATGAGTCCAGAGGTAAGGGGG + Intronic
1093024224 12:14232191-14232213 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1093302125 12:17471174-17471196 AGATGGGTCTGAAGAAAAGGAGG - Intergenic
1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG + Intergenic
1094806614 12:34100385-34100407 AGCTGGGTATAGAGGGAAAACGG - Intergenic
1095562908 12:43586828-43586850 AGACAGGTCTTGAGGGCAGGTGG + Intergenic
1096681047 12:53255480-53255502 AGAAGGGTGGGGAGGGAAGGAGG + Intergenic
1096769495 12:53925675-53925697 AGATGTGTGTAGAAGGAACGAGG - Intergenic
1097207308 12:57333713-57333735 AAATATTTCTAGAGGGAAGGAGG + Intronic
1097221008 12:57451149-57451171 AGATGGTTCTGGAAGGATGGAGG - Intergenic
1098236142 12:68420190-68420212 AGATGGGACAAGAGGAGAGGAGG + Intergenic
1099188616 12:79541501-79541523 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1099405173 12:82250883-82250905 AGATGGGTCAAGAGAAAGGGTGG + Intronic
1099840219 12:87955409-87955431 AGAGGAGTGAAGAGGGAAGGGGG - Intergenic
1100391338 12:94148482-94148504 AGATGGGCGTGGAGGGAGGGCGG + Intergenic
1101075590 12:101126662-101126684 AGAGGAGTCTGGAAGGAAGGTGG - Intronic
1102019148 12:109669660-109669682 AGAGGGGTCGGGTGGGAAGGTGG + Intergenic
1102392232 12:112558483-112558505 AGATGGGTGGTGGGGGAAGGCGG - Intergenic
1102984447 12:117266965-117266987 AGACAGGGCAAGAGGGAAGGAGG - Intronic
1103930734 12:124449534-124449556 AGGTGGGTCTGGAGAGACGGAGG - Intronic
1104260542 12:127178070-127178092 AGATGGGTCTTGAGAGAACAGGG - Intergenic
1104436003 12:128757156-128757178 AGACTGGTCTTCAGGGAAGGAGG + Intergenic
1104851390 12:131876516-131876538 AGCTGGGTATAGAGGGACAGTGG + Intergenic
1105623827 13:22093997-22094019 GGATGGTGCTGGAGGGAAGGTGG + Intergenic
1110001288 13:70204834-70204856 GGATGGGACTACAGGGAAGAAGG - Intergenic
1110284378 13:73732595-73732617 TGAGAGGTCAAGAGGGAAGGGGG - Intronic
1112095379 13:96126887-96126909 AGCTGGGGGTAGAGGAAAGGAGG - Intronic
1112321326 13:98410291-98410313 AGCTGGGTCTAAAGGGACAGGGG - Intronic
1113896810 13:113769832-113769854 AGCAGGGTTTAGAGGGGAGGTGG + Intronic
1114771156 14:25429811-25429833 AGATGGGTCCACAGAAAAGGAGG + Intergenic
1117012777 14:51487858-51487880 TGATAGGTATAGAGGGAAGTAGG + Intergenic
1117672584 14:58123547-58123569 AGCTGGGTCTAGAGGGACAACGG - Intronic
1118487145 14:66224866-66224888 AGATGGGGCAAGGGGCAAGGTGG - Intergenic
1118487186 14:66225089-66225111 AGAGGGGTGGAGTGGGAAGGCGG - Intergenic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1119662184 14:76459922-76459944 AGATGGGGAGAGAGGGAGGGAGG + Intronic
1120593828 14:86408922-86408944 AGATGTGTCTAGATGAAAGGAGG - Intergenic
1121423539 14:93832408-93832430 AGATTGATCTTGAGGGAGGGAGG + Intergenic
1122980729 14:105191390-105191412 AGATGGGTCTCAGGGGGAGGCGG - Intergenic
1123817785 15:23997240-23997262 ACATGCTTCTAGAGAGAAGGCGG + Intergenic
1125993164 15:44130132-44130154 TGATGGGTTTAGAGGGGAGAGGG - Intronic
1126944275 15:53801475-53801497 AGCTGGGGCTAGAGGAAATGGGG + Intergenic
1128270805 15:66307790-66307812 AGATGGAGATGGAGGGAAGGTGG + Intronic
1128428897 15:67572262-67572284 AGATGGGGCTTGGAGGAAGGTGG + Intronic
1129044886 15:72725784-72725806 GGATGGGGGAAGAGGGAAGGAGG - Intronic
1129845531 15:78766199-78766221 AGCTGGGTCTCGGGGGCAGGTGG + Exonic
1130233476 15:82114000-82114022 AGATAGATGAAGAGGGAAGGAGG - Intergenic
1130673188 15:85930782-85930804 AGAAGGGGGTAGAGAGAAGGGGG - Intergenic
1131055478 15:89372052-89372074 AGATGGGTGTGAAGGGAAGGTGG + Intergenic
1131651052 15:94400108-94400130 AGATGGGGCAAGAGGGAGAGAGG - Intronic
1132110368 15:99098392-99098414 AGCTGGGTCTAGGGAGCAGGAGG - Intronic
1134052493 16:11146538-11146560 GGATGGGTATAGAAGGATGGAGG + Intronic
1134370088 16:13615294-13615316 AGAAGGAACTGGAGGGAAGGAGG - Intergenic
1134670049 16:16048003-16048025 AGATAGGTCGGGAGGGGAGGAGG + Intronic
1134886818 16:17800508-17800530 AGAAGGGTAGAGAGGGAAAGGGG - Intergenic
1135936687 16:26786395-26786417 AGGGGGGTCAAGAGGGAATGTGG + Intergenic
1136412524 16:30085658-30085680 AGATGGGCCTAGAGGGCCAGTGG + Intergenic
1137708377 16:50549898-50549920 AGTAGGGGCTAGAGAGAAGGGGG + Intronic
1137936242 16:52637982-52638004 AGAGAGGTCTAGAGTGAAAGAGG + Intergenic
1138543325 16:57701600-57701622 AGGTGGGTATCGAAGGAAGGGGG + Intronic
1139562944 16:67755282-67755304 AGGTGGGTCTAGAGAGAGGATGG + Intronic
1139688748 16:68625196-68625218 AGTTCGGGCTAGAGGCAAGGTGG - Intergenic
1140668224 16:77247692-77247714 AGCGGGGTCTAAAGGGAAAGAGG - Intergenic
1140912409 16:79466208-79466230 GGGTGGGTCTAGAGGGAGTGAGG - Intergenic
1141342062 16:83212585-83212607 AAATAGGTCTAGAAAGAAGGTGG + Intronic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141855779 16:86680832-86680854 AGATGCGTCTAGAGGGAGAGGGG + Intergenic
1141892579 16:86936406-86936428 ATATGGGACCAGAGGGAGGGAGG + Intergenic
1146000288 17:29126627-29126649 AGAGGGGTCTGGAGGGTATGGGG - Intronic
1146479935 17:33197103-33197125 AAATGGGTAGAGAGTGAAGGTGG + Intronic
1146640793 17:34539836-34539858 AGTTGGAGCTGGAGGGAAGGTGG - Intergenic
1146722930 17:35136073-35136095 AGCTGGGTCTAGAAGGGAGAAGG + Intronic
1146805229 17:35859561-35859583 AGCTGGGTCAAGAGGGACAGAGG - Intronic
1147678620 17:42224708-42224730 AGGTGGGTCCAGAGGGAGGTGGG + Intronic
1148439169 17:47702895-47702917 AGCTGGGCCCAGAGAGAAGGGGG - Intronic
1149605897 17:57924915-57924937 AGATGAGTTTGGAGGGGAGGGGG + Intronic
1150646097 17:66978409-66978431 AGATGGGTCTCAGAGGAAGGGGG + Intronic
1150729512 17:67679818-67679840 AGATGGGGTGAGAGGGAAGGTGG + Intronic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1152907826 17:82978769-82978791 AGTTGAGTCTAGAGACAAGGAGG + Intronic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1156481072 18:37436751-37436773 GGCTGGGGCTAGAGGGAAGTCGG + Intronic
1157082021 18:44535704-44535726 AGGTGGGTTTTGAGGGAAAGAGG + Intergenic
1157721839 18:49931371-49931393 AGATGGGTGTGGAAAGAAGGTGG - Intronic
1158514371 18:58119178-58119200 AGATGGGGACAAAGGGAAGGTGG - Intronic
1158644990 18:59237888-59237910 AGATTATTCTGGAGGGAAGGAGG + Intergenic
1158861611 18:61598051-61598073 AGAGGAGTCTAGAGGTAGGGTGG - Intergenic
1159100942 18:63957545-63957567 AGATTGGTATAAAGTGAAGGTGG + Intronic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1162261891 19:9540657-9540679 AGATGGGTCCATAGAAAAGGAGG - Intergenic
1164004185 19:21133876-21133898 AGATGGGTCCATAGGAAAGGAGG + Intergenic
1164449146 19:28345028-28345050 AGATGGGGCTGGAAGGATGGTGG + Intergenic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1167028893 19:46943519-46943541 AGATGGGGTGAGAGGGCAGGTGG - Intronic
1167284500 19:48591521-48591543 AGAGGGGTCTCCAGGGCAGGAGG + Intronic
1167598081 19:50437748-50437770 AGATGGGACTCAAGGGGAGGAGG + Intronic
1167636969 19:50660919-50660941 AAAAGGGGCAAGAGGGAAGGCGG + Intronic
1167641670 19:50686033-50686055 AGATGGGATTTGAGGGAAAGGGG + Intronic
1167726336 19:51215674-51215696 AGATGGGGCTAAAGAGAAGTGGG - Intergenic
1168693715 19:58393344-58393366 AGAGGGTTCTAGAGAGAAGGGGG - Exonic
1168705063 19:58465900-58465922 AGGTAGGTATAGAGGGAGGGAGG + Intergenic
925153695 2:1634693-1634715 GGATGGGACTAGAGAGAGGGGGG + Intronic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
925433950 2:3819988-3820010 AGATGGGTCTGTAGAAAAGGAGG + Intronic
925865936 2:8225783-8225805 AGATGCGACAAGAGGAAAGGAGG - Intergenic
926355502 2:12037474-12037496 ACATGGTTCAAGAAGGAAGGAGG - Intergenic
926627181 2:15101993-15102015 AGCTGGGTCTTGAAGGCAGGAGG - Intergenic
927877805 2:26670482-26670504 GGATGGGTCTCTAGAGAAGGTGG + Intergenic
930148394 2:48031760-48031782 GGATGGGGCAGGAGGGAAGGGGG - Intergenic
931084604 2:58815377-58815399 AAATGGTTCTAGAGAGAAGTGGG + Intergenic
931113445 2:59138558-59138580 AGATGGTTATAGTGGGAAAGAGG - Intergenic
932368213 2:71166619-71166641 AACTGGGCCTAGAGGGAAGGGGG - Intergenic
932503557 2:72206370-72206392 AGAAGGGTCTTGAAGGATGGTGG - Intronic
932850291 2:75178056-75178078 TTCTGGATCTAGAGGGAAGGTGG - Intronic
933892163 2:86781953-86781975 AGATGTGTCTGAAGGGATGGAGG + Intergenic
934766330 2:96882185-96882207 AGAGGGGTCTGGTGGGAGGGTGG - Intronic
935069278 2:99679414-99679436 AGATGGGCCTGCAGAGAAGGTGG - Intronic
935071781 2:99700796-99700818 AGATGGGGACAGGGGGAAGGAGG + Intronic
935829023 2:106979892-106979914 AGAGGGCTCAAGAGGGATGGTGG + Intergenic
935998238 2:108797513-108797535 AGATGGTTGTAAAGGGGAGGAGG + Intronic
936350100 2:111706152-111706174 ACTTGGGCTTAGAGGGAAGGTGG - Intergenic
936527983 2:113255107-113255129 AGAGAGGAATAGAGGGAAGGAGG + Intronic
936611334 2:114004869-114004891 AGATGGGTGTGGTGGGGAGGTGG + Intergenic
936870692 2:117131917-117131939 AGATGGGTCCATAGAAAAGGGGG - Intergenic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
939778314 2:146413123-146413145 AGATGGATAGAGTGGGAAGGTGG + Intergenic
940429997 2:153578532-153578554 TGATGGGTCTACAGTCAAGGTGG - Intergenic
940857026 2:158737274-158737296 AGACTGGTCTATAGGGCAGGAGG - Intergenic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
943601122 2:189922436-189922458 ACATGGGTATAGAGAGAAGTAGG + Intronic
943668134 2:190632146-190632168 TGCTAGGTCTAGAGGGAAGTGGG + Intergenic
943677439 2:190729799-190729821 AGAAGGGACCAAAGGGAAGGAGG + Intergenic
944142769 2:196475326-196475348 AGATGGGGGGAGAGGGAGGGAGG + Intronic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
947469884 2:230391700-230391722 AGATGGCTCTGGAGGCAATGTGG - Intronic
947978154 2:234385483-234385505 AGATGCGTGCAGAGGGAAGATGG - Intergenic
1168803693 20:660742-660764 AGAGGGGTGTGAAGGGAAGGCGG + Intronic
1169218755 20:3808355-3808377 AGTAGTGTCTGGAGGGAAGGGGG + Intergenic
1169901955 20:10562321-10562343 AGGGGGATCTAGTGGGAAGGTGG + Intronic
1169922777 20:10753181-10753203 AGAGGGGGATAGAGGGAGGGAGG + Intergenic
1172202502 20:33136352-33136374 AGATGGGTGGAGGAGGAAGGTGG - Intergenic
1172750277 20:37245905-37245927 AGGTGGGTCTGGGAGGAAGGAGG + Intergenic
1172754945 20:37276959-37276981 AGATGGAGCTAAAGGGGAGGGGG + Intergenic
1172767037 20:37356452-37356474 AGATGGGCCTGGAGAGAAGCAGG + Intronic
1173856960 20:46256503-46256525 GCATGTGTCTAGTGGGAAGGAGG + Intronic
1175926225 20:62472963-62472985 GGATGAGGCTTGAGGGAAGGTGG - Intronic
1177775403 21:25561426-25561448 AGATGGGAGTGGAGGGCAGGGGG + Intergenic
1178086615 21:29118727-29118749 AGATGAGTATGGAGGAAAGGAGG + Intronic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178365481 21:31986095-31986117 AGAGGGGTCTAGAGTTCAGGGGG - Intronic
1179040518 21:37798336-37798358 ACATGAGGCTAGTGGGAAGGAGG - Intronic
1179714662 21:43280718-43280740 AGATGGAGGTAGAGGGGAGGTGG + Intergenic
1180085595 21:45506732-45506754 GGAGGGCTCTAGAAGGAAGGTGG - Intronic
1180085602 21:45506754-45506776 GGAGGGTTCCAGAGGGAAGGTGG - Intronic
1180085610 21:45506776-45506798 GGAGGGCTCCAGAGGGAAGGTGG - Intronic
1180938550 22:19641875-19641897 AGAGGGGTGGAGGGGGAAGGTGG + Intergenic
1181534068 22:23532821-23532843 AGATGGGGGAAGAGGGAGGGAGG + Intergenic
1181618012 22:24068205-24068227 AGAAGGGGGTGGAGGGAAGGAGG + Intronic
1181964662 22:26647975-26647997 AGATGGGGCTAGAAGGAATTGGG - Intergenic
1182413416 22:30205694-30205716 AGATGAGTCTTGGGGGAGGGAGG + Intergenic
1182503052 22:30762586-30762608 GGATGGGTCTAGAGCGCAAGAGG - Intronic
1183266287 22:36827973-36827995 AGCGGGGGCTGGAGGGAAGGAGG + Intergenic
1183459612 22:37941918-37941940 AGAGGTGTGTAGAGGGAAGGGGG - Exonic
1183832392 22:40425230-40425252 AGATGGGAACAGAGGCAAGGAGG + Intronic
1183966570 22:41446206-41446228 AGTGGGGTCTGGAGGGAAGCTGG + Intronic
1184293171 22:43508923-43508945 AGATGGGGATGGAGGGATGGGGG - Intergenic
1184452810 22:44592876-44592898 AAATAGGTCTAAAAGGAAGGAGG + Intergenic
1184606028 22:45575359-45575381 AGAAGGGTCTGGAGGTATGGGGG + Intronic
1184884798 22:47336330-47336352 AGATGAGGATAGAGGGATGGAGG - Intergenic
949515352 3:4802410-4802432 AGGAGGGACTAGAGGCAAGGAGG + Intronic
949663751 3:6313137-6313159 AGAGGGAGCTAGAGGGAAGGAGG - Intergenic
950139387 3:10604757-10604779 TGATGGCTCTAAAGGGAAGTAGG - Intronic
950203853 3:11062951-11062973 AGATGAGTGTGGAGGGAGGGAGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
952883659 3:38000297-38000319 AGATGGGGCAAGGGGGAAGAAGG + Intronic
952955344 3:38553874-38553896 AGATGGGTCCCCAGGGATGGGGG - Intronic
953312377 3:41891332-41891354 AGACGGGACTGGAGGGAGGGAGG + Intronic
953599544 3:44349106-44349128 AGATGGGTCCACAGAAAAGGAGG + Intronic
954104612 3:48403276-48403298 AGTTGGGTCTGTAGGGCAGGGGG - Intergenic
954286115 3:49620553-49620575 AGATGAGGCCAGAGGGAAAGGGG + Intronic
954421730 3:50422406-50422428 GGCTGAGGCTAGAGGGAAGGAGG - Intronic
959543806 3:107570753-107570775 AGATGGGTCTGCAGAAAAGGAGG + Intronic
961173559 3:124816099-124816121 AGATGGGAGCAGTGGGAAGGGGG + Intronic
961916296 3:130378594-130378616 AGATGAGGCCAGAGGGAAGCAGG - Intronic
962090991 3:132244128-132244150 AGATGCTTCTAAAGGCAAGGAGG - Intronic
962318591 3:134373774-134373796 AGAGGGCTCGAGAGGGAGGGAGG - Intronic
962452849 3:135535288-135535310 AGGTGGGACAAGAGGGAAAGAGG + Intergenic
962575987 3:136755494-136755516 AGTGGGGAGTAGAGGGAAGGTGG - Intergenic
962755668 3:138464001-138464023 AGAGGGGTCTGGAGTAAAGGAGG + Intronic
962846332 3:139277333-139277355 AGATGTTTATAGAGGGAATGGGG + Intronic
964592048 3:158376063-158376085 AGGGGGGTCGAGAGGGAGGGAGG - Intronic
964592484 3:158379838-158379860 AAATGGGACAAGAGGGAGGGAGG - Intronic
966398548 3:179525019-179525041 AGATGGGTCTGTAGAAAAGGAGG + Intergenic
966836522 3:184053608-184053630 AGATGGAGATAGAGAGAAGGAGG + Intronic
969462253 4:7334950-7334972 AGACGGGTGTGGAGGGAGGGAGG + Intronic
969939195 4:10713412-10713434 AGATGGTGCTAGGAGGAAGGGGG + Intergenic
970043115 4:11818917-11818939 AGATGAGGCTTGAGGTAAGGAGG + Intergenic
970347205 4:15163974-15163996 AGCACGGTCTAGAGGGATGGTGG - Intergenic
972291539 4:37694315-37694337 AGATCGGGATAGTGGGAAGGAGG + Intergenic
973613394 4:52658109-52658131 GGAGGGGGCTAGAGGGGAGGCGG + Intronic
974396846 4:61347550-61347572 ATATGAGGCCAGAGGGAAGGGGG - Intronic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
974738920 4:65979048-65979070 AGATGGGGGAAGAAGGAAGGGGG - Intergenic
976113593 4:81702648-81702670 TGATCGGTCTAAAGGGCAGGTGG - Intronic
977557134 4:98497750-98497772 AGCTGAGTCTAGAGGGGAGACGG + Intronic
977758986 4:100708059-100708081 AAAAGTGGCTAGAGGGAAGGAGG + Intronic
978349352 4:107805166-107805188 TGATGGGTTTAGAGAGAAGGAGG - Intergenic
978445917 4:108779780-108779802 AGCTGGCTCTGCAGGGAAGGAGG + Intergenic
979798398 4:124876095-124876117 AGATGGGTCCATAGAAAAGGAGG + Intergenic
980270156 4:130573947-130573969 AGATGGCAAAAGAGGGAAGGAGG + Intergenic
980790504 4:137613758-137613780 AGATGGGTAGAGAGGCAAGAAGG - Intergenic
981008146 4:139896843-139896865 GGATGGTTCTACAGGGAAAGGGG + Intronic
981132415 4:141172468-141172490 AAATGTGTGTATAGGGAAGGGGG - Intronic
981485057 4:145277159-145277181 AGAAGGGTCTCCAGGGATGGTGG + Intergenic
982720130 4:158850626-158850648 AGTGGGGGCTGGAGGGAAGGAGG + Intronic
983354863 4:166644073-166644095 AGATTGGTCTAGAGGGGAAAGGG - Intergenic
983698379 4:170560872-170560894 AAATGGGTCAATAGGGAAAGGGG + Intergenic
983961464 4:173760270-173760292 AAATGGTTCTACAGGGGAGGTGG + Intergenic
985011131 4:185583189-185583211 AGAATGGTGGAGAGGGAAGGAGG + Intergenic
985079108 4:186246247-186246269 AGATGGGTCCATAGAAAAGGAGG + Intronic
985137484 4:186801781-186801803 AGGAGGGTCCAGAGGGAAGTTGG + Intergenic
985817114 5:2135321-2135343 AGATAGTGCTGGAGGGAAGGGGG + Intergenic
986906547 5:12501233-12501255 ACATCAGTGTAGAGGGAAGGGGG - Intergenic
987767688 5:22255186-22255208 AGCTAGGTCTAAAGGGAAAGTGG + Intronic
988495281 5:31740042-31740064 AGATGGGTCAAGAGAAAAGATGG - Intronic
988986208 5:36621367-36621389 AGATGGGTTCTGAGGCAAGGTGG + Intronic
990442644 5:55861932-55861954 ATATGAGTATAGAGGGAAGGAGG + Intronic
990581719 5:57172909-57172931 ACATTTGTTTAGAGGGAAGGTGG - Intergenic
990980024 5:61593910-61593932 AGGTGGGTATAGAAGGATGGTGG - Intergenic
991631004 5:68656333-68656355 GGATGGGTCTCCAGGGAAAGGGG - Intergenic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
993571420 5:89544117-89544139 AGGTGAGTCTAGAGACAAGGAGG - Intergenic
994324719 5:98435842-98435864 AGATGGGTCCATAGAAAAGGAGG - Intergenic
994910538 5:105899783-105899805 AGATGGGAGTAGAGTGAAGAAGG - Intergenic
995615672 5:113960493-113960515 TGAGGGATTTAGAGGGAAGGGGG + Intergenic
996713095 5:126562972-126562994 GGCTGGGTGTAGTGGGAAGGAGG + Intronic
996871656 5:128199405-128199427 TGATGGGGCTACAGGAAAGGCGG - Intergenic
997408322 5:133670003-133670025 ACAGGGGTCTTGAGGGAATGTGG - Intergenic
997516042 5:134490669-134490691 AGCTGGGTAAGGAGGGAAGGCGG - Intergenic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1000373853 5:160561257-160561279 AGATGAGGCTGGAGGGCAGGTGG - Intergenic
1000606824 5:163335643-163335665 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1001263581 5:170255090-170255112 AGATGGCTACAGAGGCAAGGAGG + Intronic
1002106004 5:176879704-176879726 AGATGGCTGTGGAGGGGAGGGGG - Exonic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1003111880 6:3258084-3258106 TGATGGGTTAAGAGAGAAGGTGG - Intronic
1003831134 6:10012974-10012996 AGATTATTCTAGAGGCAAGGAGG + Intronic
1003962095 6:11218409-11218431 AGATGGGTTTCGAGGGAGGAAGG - Intronic
1005717194 6:28561128-28561150 AGATGGGTCTAAAGGGAACTTGG - Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1006050997 6:31344226-31344248 AGGTGGGCCTGGAGGGAGGGAGG + Intronic
1006338325 6:33432287-33432309 AGTTGGGGCTGGAGGGGAGGGGG - Intronic
1006427902 6:33977617-33977639 AGTTGGATCTGGAGGGGAGGTGG + Intergenic
1007084697 6:39135114-39135136 AGATGAGTCTGTAGGAAAGGAGG + Intergenic
1007110500 6:39310861-39310883 AGATGGGGCCAGGGGGATGGGGG - Intronic
1007247368 6:40472192-40472214 TGAAGGGGCTGGAGGGAAGGTGG - Intronic
1007390168 6:41546310-41546332 AGGAGGGTGGAGAGGGAAGGAGG - Intergenic
1013256810 6:108395775-108395797 AGATAGGTAGAGAGGGAGGGAGG + Intronic
1015711439 6:136145762-136145784 AGATGGGTTTAGAGAAAAGTAGG - Intronic
1015966827 6:138702672-138702694 AGAAGGGGTAAGAGGGAAGGGGG - Intergenic
1016123974 6:140376455-140376477 AGAGAGGGCTAGAGGGAGGGAGG - Intergenic
1016124005 6:140376570-140376592 AGAGAGGGCTAGAGGGAGGGAGG - Intergenic
1017269705 6:152491807-152491829 AGATGGGTCCATAGAAAAGGAGG - Intronic
1018577886 6:165278443-165278465 AGCTGGATATAGAGGGAAAGGGG - Intergenic
1019178794 6:170174904-170174926 AGGCGGGCCTAGAGGGATGGTGG - Intergenic
1019552571 7:1610500-1610522 AGATGGGTCTCCAGGAAAGCAGG + Intergenic
1020080004 7:5282150-5282172 AGATGGGAGCAGAGGGGAGGAGG + Intronic
1021420889 7:20443540-20443562 AGAGGGGTCGAGAGGGGAGTTGG + Intergenic
1022447307 7:30480864-30480886 AGATGGGTCCATAGAAAAGGAGG - Intergenic
1022632082 7:32094814-32094836 AGATGGAGCTGGAGAGAAGGTGG - Intronic
1023050910 7:36250350-36250372 GGAAGGGACTAGAGGGATGGAGG + Intronic
1023369926 7:39503013-39503035 AGAAGGGTCCAGAGTGCAGGGGG - Intergenic
1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG + Intergenic
1024739359 7:52337734-52337756 AGATGGGTCTGTAGAAAAGGAGG + Intergenic
1024991176 7:55235468-55235490 CGGTGGCTCTAGCGGGAAGGTGG + Intronic
1025075887 7:55942815-55942837 AGAGGGGTCAAGAGAGATGGGGG + Intergenic
1025198910 7:56950066-56950088 AGATGGGAGCAGAGGGGAGGAGG - Intergenic
1025673036 7:63626867-63626889 AGATGGGAGCAGAGGGGAGGAGG + Intergenic
1026896955 7:74014828-74014850 ACAGGGGTGTAGTGGGAAGGGGG + Intergenic
1027354315 7:77341293-77341315 AGATGGGTCTGTAGAAAAGGAGG - Intronic
1028143970 7:87301125-87301147 ACTTGAGTGTAGAGGGAAGGAGG + Intergenic
1028590013 7:92483900-92483922 AGATGGGTCTGTAGCAAAGGAGG + Intergenic
1028630399 7:92927452-92927474 AAAAGGGTCTAGAGGGATGATGG + Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032461831 7:132117712-132117734 AGGTGGGTCAAGAGGGTATGCGG - Intergenic
1032467392 7:132154703-132154725 AGAAGAGTTTAGAGGGCAGGTGG + Intronic
1033625478 7:143106446-143106468 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1034032651 7:147785329-147785351 GGATGGCTCAGGAGGGAAGGGGG + Intronic
1036549560 8:9804564-9804586 AGATGGGTCCATAGAAAAGGAGG - Intergenic
1036744851 8:11399356-11399378 TGATGGGTCTCCAGGGGAGGGGG + Intronic
1037686273 8:21142101-21142123 AGATGGTGCTAGAGGGTAGAGGG + Intergenic
1037806464 8:22060261-22060283 AGAGGGGTCTGGATGGGAGGAGG + Intronic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1038672000 8:29590121-29590143 AGCTGGGTCAAGGAGGAAGGAGG - Intergenic
1040902286 8:52429086-52429108 AGTGGGGCCTATAGGGAAGGTGG - Intronic
1041097440 8:54363716-54363738 ACTCGGGTCTAGGGGGAAGGAGG - Intergenic
1041510374 8:58648975-58648997 TGTTGAGTCTAGAGGGCAGGTGG - Intronic
1043208155 8:77474258-77474280 AGATGGATCTAAAGTGCAGGTGG - Intergenic
1043720744 8:83545014-83545036 AGATGGGTCCATAGAAAAGGAGG - Intergenic
1045518257 8:102880235-102880257 GGATGGGTGTAGGGGGAAGGAGG - Intronic
1046074792 8:109302440-109302462 AGATGGGTCTGTAGAAAAGGAGG - Intronic
1046850013 8:118961590-118961612 AGATGGGTGGAGAGGGAGGCAGG - Intergenic
1046999903 8:120563201-120563223 AGATGGGTCTACAGAGAGTGAGG - Intronic
1047230686 8:122995693-122995715 AGATGGAGCTGGAGGGTAGGTGG - Intergenic
1047395653 8:124496496-124496518 ATAAGGGGTTAGAGGGAAGGAGG - Intronic
1049042063 8:140119911-140119933 AGATGTGTATAGAAGGAAGTAGG - Intronic
1049585828 8:143431973-143431995 AGATCTTTGTAGAGGGAAGGAGG - Intergenic
1050016256 9:1237278-1237300 AGAGGGGACTTGAGGGAGGGTGG + Intergenic
1050140368 9:2511019-2511041 AGATGGGTCCATAGAAAAGGAGG - Intergenic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1051819021 9:21143024-21143046 ACATGGGTCAGGAGGAAAGGAGG - Intergenic
1053282512 9:36830123-36830145 AGACGCATCCAGAGGGAAGGAGG + Intergenic
1053302043 9:36959170-36959192 AGAAGGGTCTGGTGGGAAGAGGG - Intronic
1053377415 9:37619389-37619411 AGAAGGGTAAAGAGGGTAGGAGG + Intronic
1053592217 9:39525980-39526002 AGGTGGGTGTAAAGGGAATGTGG - Intergenic
1053850070 9:42281321-42281343 AGGTGGGTGTAAAGGGAATGTGG - Intergenic
1054574086 9:66839305-66839327 AGGTGGGTGTAAAGGGAATGTGG + Intergenic
1055715630 9:79114714-79114736 TGATGGGCGTAGAGGGAGGGAGG - Intergenic
1056263383 9:84872034-84872056 AGATGGGTCTATAGTTAAAGTGG - Intronic
1056363601 9:85882291-85882313 AGATGGGTCTGTAGAAAAGGAGG - Intergenic
1057487780 9:95499487-95499509 AGAAGGGGCAGGAGGGAAGGGGG + Intronic
1058431763 9:104926830-104926852 AGATGGGGCTGCAGGGAACGTGG + Intronic
1058579078 9:106435396-106435418 AGCTGGGTCTGGAGAGATGGGGG - Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059286575 9:113177764-113177786 ACATGGGACTAGTGGGCAGGGGG - Intronic
1059383881 9:113949374-113949396 ACAGGGGTCTGGAGGGATGGTGG - Intronic
1059769585 9:117413793-117413815 AGGTGGGTAGAAAGGGAAGGCGG + Intronic
1061633755 9:131891848-131891870 AGAGGGGTGGAGAGGGATGGGGG + Intronic
1062115442 9:134805822-134805844 CGTGGGCTCTAGAGGGAAGGGGG + Intronic
1062616373 9:137398364-137398386 ACAGGGGACAAGAGGGAAGGGGG - Intronic
1185740336 X:2526867-2526889 AGATGGGTGTAGCAGGAAGAAGG + Intergenic
1188281048 X:28269713-28269735 AGATGGGGCTAGTGGGATTGGGG + Intergenic
1189500300 X:41550218-41550240 AGATGGGGGTGGAGGGAGGGAGG - Intronic
1190219226 X:48500302-48500324 AGCTGGCTCTAGAAGGAAGAAGG + Intergenic
1191103959 X:56760807-56760829 AGAAGAATCCAGAGGGAAGGAGG - Intergenic
1191105308 X:56768725-56768747 AGAAGAATCCAGAGGGAAGGAGG - Intergenic
1191106301 X:56774127-56774149 AGAAGAATCCAGAGGGAAGGAGG - Intergenic
1191107294 X:56779529-56779551 AGAAGAATCCAGAGGGAAGGAGG - Intergenic
1191108809 X:56789256-56789278 AGAAGAATCCAGAGGGAAGGAGG - Intergenic
1191109634 X:56794531-56794553 AGAAGAATCTAGAGGGAAGGGGG - Intergenic
1191111152 X:56803940-56803962 AGAGGAATCCAGAGGGAAGGAGG - Intergenic
1192706883 X:73535615-73535637 AGATGCTTCTAAAGGCAAGGAGG + Intergenic
1192731621 X:73807002-73807024 AGATGGGTCTGTAGAAAAGGAGG + Intergenic
1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG + Intronic
1195450370 X:105005035-105005057 AGATCGGTGTAGAGGGAGGAAGG - Intronic
1196527190 X:116740472-116740494 AGCTGGGTATAGAGGGAAAACGG + Intergenic
1198053670 X:132973078-132973100 AGCTTGGGCTAGAGGGGAGGAGG + Intergenic
1199452438 X:147991551-147991573 TGAGGGGACTTGAGGGAAGGAGG - Intronic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201691806 Y:16775161-16775183 AAATGGGGGTTGAGGGAAGGAGG - Intergenic
1201906324 Y:19089262-19089284 ATATGGTTTCAGAGGGAAGGTGG - Intergenic
1202039732 Y:20669066-20669088 AGAGGTGTCTACAGGGAAGAGGG - Intergenic
1202163646 Y:21963253-21963275 AGATGAGGGGAGAGGGAAGGAGG - Intergenic
1202227710 Y:22623112-22623134 AGATGAGGGGAGAGGGAAGGAGG + Intergenic
1202315447 Y:23573066-23573088 AGATGAGGGGAGAGGGAAGGAGG - Intergenic
1202555354 Y:26097531-26097553 AGATGAGGGGAGAGGGAAGGAGG + Intergenic