ID: 1070820355

View in Genome Browser
Species Human (GRCh38)
Location 10:79350642-79350664
Sequence GTGGAAGTCCTGAGCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070820347_1070820355 12 Left 1070820347 10:79350607-79350629 CCAGCCCTAAGGCTGATGGTAAA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG No data
1070820344_1070820355 18 Left 1070820344 10:79350601-79350623 CCTGGCCCAGCCCTAAGGCTGAT 0: 1
1: 0
2: 1
3: 49
4: 326
Right 1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG No data
1070820346_1070820355 13 Left 1070820346 10:79350606-79350628 CCCAGCCCTAAGGCTGATGGTAA No data
Right 1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG No data
1070820348_1070820355 8 Left 1070820348 10:79350611-79350633 CCCTAAGGCTGATGGTAAAGTAG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG No data
1070820349_1070820355 7 Left 1070820349 10:79350612-79350634 CCTAAGGCTGATGGTAAAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070820355 Original CRISPR GTGGAAGTCCTGAGCCAGGG TGG Intronic
No off target data available for this crispr