ID: 1070826794

View in Genome Browser
Species Human (GRCh38)
Location 10:79394925-79394947
Sequence CCTCACACCACTCCAAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070826787_1070826794 3 Left 1070826787 10:79394899-79394921 CCCCTACTAGGAGGCAATCTAAA 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826781_1070826794 21 Left 1070826781 10:79394881-79394903 CCCTGCACCCAGTCAGCTCCCCT 0: 1
1: 1
2: 2
3: 33
4: 331
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826785_1070826794 13 Left 1070826785 10:79394889-79394911 CCAGTCAGCTCCCCTACTAGGAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826784_1070826794 14 Left 1070826784 10:79394888-79394910 CCCAGTCAGCTCCCCTACTAGGA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826780_1070826794 24 Left 1070826780 10:79394878-79394900 CCTCCCTGCACCCAGTCAGCTCC 0: 1
1: 0
2: 6
3: 69
4: 465
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826788_1070826794 2 Left 1070826788 10:79394900-79394922 CCCTACTAGGAGGCAATCTAAAT 0: 1
1: 1
2: 0
3: 4
4: 100
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826789_1070826794 1 Left 1070826789 10:79394901-79394923 CCTACTAGGAGGCAATCTAAATT 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826782_1070826794 20 Left 1070826782 10:79394882-79394904 CCTGCACCCAGTCAGCTCCCCTA 0: 1
1: 5
2: 0
3: 19
4: 246
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data
1070826779_1070826794 27 Left 1070826779 10:79394875-79394897 CCTCCTCCCTGCACCCAGTCAGC 0: 1
1: 2
2: 5
3: 75
4: 667
Right 1070826794 10:79394925-79394947 CCTCACACCACTCCAAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070826794 Original CRISPR CCTCACACCACTCCAAAGGC GGG Intronic
No off target data available for this crispr