ID: 1070828989

View in Genome Browser
Species Human (GRCh38)
Location 10:79407245-79407267
Sequence TGTCCCAGAGGAGCACTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070828977_1070828989 11 Left 1070828977 10:79407211-79407233 CCAGCCAGGTGCAGACCTGCCCC 0: 1
1: 0
2: 2
3: 47
4: 316
Right 1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG No data
1070828981_1070828989 -4 Left 1070828981 10:79407226-79407248 CCTGCCCCCAGGGAGCGCCTGTC 0: 1
1: 0
2: 3
3: 25
4: 343
Right 1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG No data
1070828978_1070828989 7 Left 1070828978 10:79407215-79407237 CCAGGTGCAGACCTGCCCCCAGG 0: 1
1: 0
2: 1
3: 49
4: 411
Right 1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG No data
1070828982_1070828989 -8 Left 1070828982 10:79407230-79407252 CCCCCAGGGAGCGCCTGTCCCAG 0: 1
1: 1
2: 3
3: 21
4: 293
Right 1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG No data
1070828983_1070828989 -9 Left 1070828983 10:79407231-79407253 CCCCAGGGAGCGCCTGTCCCAGA 0: 1
1: 0
2: 2
3: 28
4: 244
Right 1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG No data
1070828984_1070828989 -10 Left 1070828984 10:79407232-79407254 CCCAGGGAGCGCCTGTCCCAGAG 0: 1
1: 0
2: 1
3: 23
4: 219
Right 1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070828989 Original CRISPR TGTCCCAGAGGAGCACTCGG TGG Intronic
No off target data available for this crispr