ID: 1070829038

View in Genome Browser
Species Human (GRCh38)
Location 10:79407543-79407565
Sequence CAGAGTCTCAAATGCCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070829025_1070829038 21 Left 1070829025 10:79407499-79407521 CCCCAGAGTCTCAGAATCAATAG 0: 1
1: 0
2: 6
3: 63
4: 473
Right 1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG No data
1070829026_1070829038 20 Left 1070829026 10:79407500-79407522 CCCAGAGTCTCAGAATCAATAGG 0: 1
1: 0
2: 4
3: 64
4: 500
Right 1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG No data
1070829028_1070829038 19 Left 1070829028 10:79407501-79407523 CCAGAGTCTCAGAATCAATAGGT 0: 1
1: 0
2: 5
3: 72
4: 592
Right 1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG No data
1070829024_1070829038 26 Left 1070829024 10:79407494-79407516 CCTGGCCCCAGAGTCTCAGAATC 0: 1
1: 0
2: 5
3: 33
4: 369
Right 1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG No data
1070829023_1070829038 27 Left 1070829023 10:79407493-79407515 CCCTGGCCCCAGAGTCTCAGAAT 0: 1
1: 0
2: 6
3: 32
4: 320
Right 1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070829038 Original CRISPR CAGAGTCTCAAATGCCTGGG CGG Intronic
No off target data available for this crispr