ID: 1070829410

View in Genome Browser
Species Human (GRCh38)
Location 10:79409482-79409504
Sequence AATCAGAGGGGACCCCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070829410_1070829430 21 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829430 10:79409526-79409548 GGCACAGGACAGGGGGCTCTGGG No data
1070829410_1070829422 6 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829422 10:79409511-79409533 GCCCAGCGTGGGTCTGGCACAGG No data
1070829410_1070829418 -5 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829418 10:79409500-79409522 TGATTCCCTGGGCCCAGCGTGGG No data
1070829410_1070829420 0 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829420 10:79409505-79409527 CCCTGGGCCCAGCGTGGGTCTGG No data
1070829410_1070829425 11 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829425 10:79409516-79409538 GCGTGGGTCTGGCACAGGACAGG No data
1070829410_1070829428 14 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829428 10:79409519-79409541 TGGGTCTGGCACAGGACAGGGGG No data
1070829410_1070829429 20 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829429 10:79409525-79409547 TGGCACAGGACAGGGGGCTCTGG No data
1070829410_1070829426 12 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829426 10:79409517-79409539 CGTGGGTCTGGCACAGGACAGGG No data
1070829410_1070829432 28 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829432 10:79409533-79409555 GACAGGGGGCTCTGGGGAGCAGG No data
1070829410_1070829417 -6 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829417 10:79409499-79409521 CTGATTCCCTGGGCCCAGCGTGG No data
1070829410_1070829431 22 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829431 10:79409527-79409549 GCACAGGACAGGGGGCTCTGGGG No data
1070829410_1070829427 13 Left 1070829410 10:79409482-79409504 CCCTGTAGGGGTCCCCTCTGATT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1070829427 10:79409518-79409540 GTGGGTCTGGCACAGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070829410 Original CRISPR AATCAGAGGGGACCCCTACA GGG (reversed) Intronic
900964396 1:5947766-5947788 AATCACAGGGCACGCCTAGAAGG + Intronic
902182759 1:14701966-14701988 AATGAGAGGGGACACACACAGGG - Intronic
904301175 1:29555913-29555935 CATCAGTGGGGACCCCTCCCAGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
915105822 1:153534649-153534671 ACTCAGAGAGGACCCCCAGAGGG + Exonic
915488222 1:156236564-156236586 CAACACAGGGGACCCCCACAGGG + Intronic
916303743 1:163305397-163305419 AAAGAGAGGGAACCCCCACACGG - Intronic
920110181 1:203582192-203582214 AAACAGAGGGAACCCCCAGAAGG + Intergenic
920336755 1:205250050-205250072 AATCAGACAGGACCCCTACAAGG - Intronic
920530997 1:206702462-206702484 AATCTCAGTGGAGCCCTACAGGG + Intronic
921817125 1:219576661-219576683 AATCAGAGGGAACCAAAACAGGG + Intergenic
1067477476 10:46576439-46576461 AGGCTCAGGGGACCCCTACATGG - Intergenic
1067617264 10:47765345-47765367 AGGCTCAGGGGACCCCTACATGG + Intergenic
1068387601 10:56351984-56352006 AATGAGAGGGGACCCCAAGGGGG - Intergenic
1069118494 10:64538104-64538126 AAGCAGTGGGAACCCCTCCAAGG + Intergenic
1070277129 10:75018030-75018052 TATCCGAAGGGACCCCTGCATGG - Intronic
1070829410 10:79409482-79409504 AATCAGAGGGGACCCCTACAGGG - Intronic
1071566815 10:86675339-86675361 GATCAGAGGGGCCCTCTGCAGGG - Intronic
1072615421 10:97046382-97046404 AATGGGAAGGGACCCCTAGAAGG + Intronic
1072903949 10:99433456-99433478 AATTAGAGGGGCAGCCTACAAGG - Intergenic
1073261345 10:102192824-102192846 CATCAGAGGGAACCTCTACTGGG - Intergenic
1075796968 10:125127551-125127573 AATCAAAGGGTATCCCTAGAAGG + Intronic
1090128639 11:124116404-124116426 ACGCAAAGGGCACCCCTACAAGG - Intronic
1093207791 12:16271155-16271177 AAACAGAGGGGACTCCCACTGGG - Intronic
1096048724 12:48587049-48587071 AATCAGAGGGAACTCCCCCACGG + Intergenic
1102957025 12:117065402-117065424 AATCAAAGGTGACCACTGCAGGG + Intronic
1104736784 12:131139945-131139967 GAGCAGAGGGGACCCCCCCAAGG - Exonic
1109934532 13:69264445-69264467 GATCAGAGGGGTCTCCTCCAAGG - Intergenic
1110567804 13:76973897-76973919 AAGGAGAGGGGACCCCAAAAGGG - Intergenic
1111834927 13:93376171-93376193 GGTCAGAGGAGACCCCTTCATGG + Intronic
1119439458 14:74618499-74618521 ACTCAGAGCGGACCCCTAGCTGG - Intergenic
1125682065 15:41537174-41537196 AATAAGAGGGAACCCCCACACGG - Exonic
1131226305 15:90627115-90627137 AATGAGAGTGGTCCCCTTCAGGG + Intronic
1132748542 16:1446953-1446975 AGGCAGAGGGGAGCCCTGCACGG + Intronic
1140794944 16:78428453-78428475 AATCAGGGGTCACCCTTACAGGG + Intronic
1142129527 16:88426367-88426389 AGTCAGAAGGGGCCCCCACACGG + Intergenic
1143095654 17:4477040-4477062 AATCAGAGGACACCCCGAGATGG - Intronic
1146390514 17:32417972-32417994 AAACACTGGGGACTCCTACAGGG - Intergenic
1148158195 17:45435358-45435380 AAGCCCAGGGGACCCCTCCAAGG - Intergenic
1151459852 17:74248126-74248148 ACTCAGAGGGGTCCCCTGCCCGG + Intronic
1156231991 18:35162561-35162583 AACCAGAGGGGACAGCTTCAAGG + Intergenic
1158636099 18:59159593-59159615 AGTCAGAGGAGACCCCTCCAAGG + Intergenic
1160924196 19:1535261-1535283 GGTCAGAGTGGACCCCTGCATGG + Exonic
1166363345 19:42265628-42265650 AAGCAGGGGGAATCCCTACATGG + Intergenic
925318696 2:2944524-2944546 AAACAAAAGGGACCCCTAGAAGG + Intergenic
925975002 2:9136255-9136277 AATCAGAGGGCACCCACACTTGG + Intergenic
933460919 2:82584220-82584242 AATCAGAGGGGAGACAAACACGG - Intergenic
936661857 2:114551687-114551709 AAGCAAAGGGGTCCACTACAAGG - Intronic
939898076 2:147816747-147816769 AATCAGAGGCGACACATACAAGG - Intergenic
942070084 2:172308413-172308435 AATGTGAGGGGACCCATAAAGGG - Intergenic
946324599 2:218978646-218978668 AATCACAGAGGACCCCCACCAGG + Intergenic
1171953718 20:31443173-31443195 AGTCAGTGGGGACCCCAAAAGGG - Intronic
1172136506 20:32690082-32690104 CTTGAGAGGGGACCCCTGCAAGG + Intergenic
1173581753 20:44151942-44151964 AACCAGAGGTGGCCCCTGCAGGG + Intronic
1174142890 20:48428947-48428969 AAACAGAGAGGACCTCTAGAAGG - Intergenic
1179379790 21:40887812-40887834 AATCAGAGTTGACACCTACCCGG - Intergenic
1180899713 22:19361465-19361487 AAGCAGAGGGGAATGCTACAAGG + Intronic
1182354040 22:29714166-29714188 AAACACTGGGGGCCCCTACAGGG - Intergenic
1183582760 22:38735567-38735589 CAGCAGAGGGGAAGCCTACAGGG + Exonic
1184726043 22:46347205-46347227 CATCAGTGGGGACCCCTGAAGGG + Intronic
959916381 3:111821087-111821109 AATCACTGGGGACCCTGACATGG - Intronic
969098693 4:4752912-4752934 AATAGGAGGGGAGACCTACAGGG - Intergenic
969257878 4:6014962-6014984 AACCAAAGGAGACCCCTCCATGG - Intergenic
970046798 4:11863460-11863482 AATCAGATGGGAGAACTACAGGG + Intergenic
971330370 4:25676742-25676764 AATCTGGGGCGTCCCCTACAAGG - Exonic
975722682 4:77263564-77263586 AATCAGATGGAACCCTTCCAGGG - Intronic
975725398 4:77286694-77286716 AATCAGATGGAACCCTTTCAGGG - Intronic
976768967 4:88630746-88630768 AAACAGAGAGGTCCCCTGCATGG - Intronic
977192444 4:94017825-94017847 AAGCAGAGGGGAAGACTACAAGG - Intergenic
983338173 4:166421945-166421967 AATCAGTGGGTACCCATAGAGGG - Intergenic
983373631 4:166896923-166896945 AATCAGAGGGGCCCCCCAGTTGG - Intronic
990449474 5:55921135-55921157 AAAAAGAGGGGACACCTAGAGGG - Intronic
993425739 5:87762194-87762216 ACTCAGATGGCACCCCCACATGG + Intergenic
993653006 5:90544489-90544511 CATCTGTGGGGACCCCAACATGG - Intronic
997723027 5:136095783-136095805 AATTACAGTGCACCCCTACAAGG + Intergenic
1002055643 5:176596722-176596744 ACGCAGAGGGGACCCCTTCTAGG + Exonic
1003535731 6:6973813-6973835 AATCAGAGGGGACCACATCATGG - Intergenic
1005949300 6:30619593-30619615 AATCAGAAGGTACCTCTAAAGGG + Exonic
1006305296 6:33214995-33215017 AGTCACAGAGCACCCCTACACGG - Intergenic
1008747377 6:54688924-54688946 AAGCAGATGGAACCCCAACAGGG + Intergenic
1017266481 6:152451886-152451908 AATCAAAAGGGACACATACAGGG - Intronic
1022078203 7:26994171-26994193 AATCAGAGGGAACCCATTAAAGG - Intronic
1027265754 7:76494418-76494440 AAACAGACGGGGCCCCCACACGG + Intronic
1027317123 7:76992535-76992557 AAACAGACGGGGCCCCCACACGG + Intergenic
1028019338 7:85750424-85750446 AATCGGAGGGGGCACCTCCAAGG + Intergenic
1029380170 7:100209028-100209050 AACCAGAGGGGACACTTACAAGG + Intronic
1032758672 7:134916654-134916676 AATTAAAGGGGATCCCTGCAAGG - Intronic
1032768569 7:135024193-135024215 GATTGGAGGGGACTCCTACAAGG + Intronic
1037020713 8:13966828-13966850 TAACAGAGGGGACATCTACAAGG + Intergenic
1045492608 8:102681717-102681739 AATCAGACGTGACCTCCACATGG - Intergenic
1049055210 8:140230938-140230960 AGTCAGAGGGACCCCCTAAAAGG - Intronic
1055707641 9:79023988-79024010 AATCACTGGGGAACCATACAGGG - Intergenic
1060890577 9:127185393-127185415 ACACAGAGGGGACCCCTGGAGGG - Intronic
1062536025 9:137021501-137021523 AGTCAGAAGGGAGCCCTGCAGGG - Exonic
1062679641 9:137771840-137771862 AGTCACAGGGGACCCCAACTTGG + Intronic
1194013058 X:88585138-88585160 AATCAGAGGGGGCTCCTCCAAGG + Intergenic
1194956851 X:100190777-100190799 AAGCAGAGTGGACCCCTGAAAGG - Intergenic
1198639135 X:138736920-138736942 AAGCAGAGGGGAACACAACAAGG + Intronic