ID: 1070830400

View in Genome Browser
Species Human (GRCh38)
Location 10:79414749-79414771
Sequence ATCCAGGGTGGGCCTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 399}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830400 Original CRISPR ATCCAGGGTGGGCCTGGCCA AGG (reversed) Intronic
900625595 1:3607219-3607241 GTCCAGGGTGGGGTTGGCAAGGG - Intronic
900822944 1:4903399-4903421 AGTCAGGGTGGCCCTGGCCTAGG + Intergenic
901177389 1:7314364-7314386 GTCCAGGGAGGGCCTTGCAATGG + Intronic
901198792 1:7455067-7455089 ATCCAGGGCCGGCCTGGCTGGGG + Intronic
901450528 1:9333897-9333919 AGGCAGGTGGGGCCTGGCCAGGG + Intronic
901662037 1:10804570-10804592 ATGGAGGGCGGGGCTGGCCATGG + Intergenic
901954545 1:12774932-12774954 CTCCAGGGTGGGGATGGCCAAGG - Exonic
901975739 1:12942432-12942454 CTCCAGGGTGGACATGGCCAAGG + Exonic
901983333 1:13053567-13053589 CTCCAGGGTGGACATGGCCAAGG + Intronic
901985677 1:13073764-13073786 CTCCAGGGTGGACATGGCCAAGG - Exonic
901996132 1:13153003-13153025 CTCCAGGGTGGACATGGCCAAGG + Intergenic
901998755 1:13175351-13175373 CTCCAGGGTGGACATGGCCAAGG - Intergenic
902009435 1:13259333-13259355 CTCCAGGGTGGACATGGCCAAGG - Exonic
902030153 1:13416419-13416441 CTCCAGGGTGGAGATGGCCAAGG - Exonic
902032642 1:13434155-13434177 ATCCCGGGTGGGCGTGGGCTCGG - Intergenic
902733945 1:18387746-18387768 ATACAGGGTGTGCCTGACCTGGG + Intergenic
902791697 1:18773168-18773190 ATCCAGGATGGTCCTGCCAAGGG - Intergenic
903224644 1:21887741-21887763 GTACAGGGTGGGCCTGGGGAGGG - Intronic
903792559 1:25905471-25905493 ACCCAGGATGGGCGTGGCCCTGG + Intronic
904405640 1:30286394-30286416 ATTCAGGCTGGGCCTGGCCCTGG - Intergenic
905866731 1:41380945-41380967 TTGCTGGGAGGGCCTGGCCAGGG - Intronic
907409049 1:54272104-54272126 ATCACAGGTGGGCCTGGCCTAGG + Intronic
907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG + Intronic
909871397 1:80743760-80743782 ATCCAGGGTGGGGATGGTAATGG - Intergenic
910261620 1:85298716-85298738 CTCCAGGTAGGCCCTGGCCAGGG + Intergenic
912423585 1:109565831-109565853 AGCCAGGTTGAGCCTGGTCAGGG + Intronic
914852973 1:151328303-151328325 CTCCAGGGAGGGGCTGGACAGGG + Intergenic
917755544 1:178094243-178094265 ATCCAGCGTGGCCCCGACCAAGG - Exonic
917799942 1:178561213-178561235 ATTCAGGGTTGGCCTGGCATTGG + Intergenic
918462477 1:184790498-184790520 TCCCAGGGTGGACCTGGCCAGGG - Intergenic
920117078 1:203628743-203628765 TTCCAGGCTGGGCCAGGCCCAGG + Intronic
920377288 1:205515998-205516020 ATCCAGGCTGGGGCAGGGCAAGG + Intronic
920445653 1:206014184-206014206 ACCCAGGATGGTCCTGGCCTTGG - Intronic
920651321 1:207839552-207839574 ATCCAGGATGGCCATGGCCAAGG + Intergenic
921748026 1:218759762-218759784 ATCTATGGTGGGTCTAGCCAGGG + Intergenic
922043405 1:221919244-221919266 ATCAAGGCTGTGCCAGGCCACGG - Intergenic
924600006 1:245480309-245480331 ATGCAGGGTGGGATTGGGCATGG + Intronic
924824442 1:247524441-247524463 ATGCAGGGTGAGCCTGGAGAAGG - Intronic
1063045441 10:2387476-2387498 ATCCAGGGAGGGCAAGGCCTGGG - Intergenic
1063465653 10:6242385-6242407 GCCCAGGACGGGCCTGGCCAGGG + Intergenic
1063641999 10:7839208-7839230 AGCCAGGGTGGGCATGGTGATGG - Intronic
1064459743 10:15522670-15522692 ATTCAGGGTGAGCCAGGCAATGG + Intronic
1067021990 10:42808868-42808890 AGCAAGGGTGGTACTGGCCAAGG - Intronic
1067249748 10:44576342-44576364 ACCCAGGGTGGGCCTGGTGGAGG - Intergenic
1067385938 10:45817693-45817715 TTCCAGGCTGGGCAGGGCCAAGG - Intergenic
1067453453 10:46396822-46396844 CAACAGGGTGGGGCTGGCCAGGG + Intergenic
1067583778 10:47462924-47462946 CAACAGGGTGGGGCTGGCCAGGG - Intronic
1067633782 10:47988272-47988294 CAACAGGGTGGGGCTGGCCAGGG - Intergenic
1069611112 10:69773212-69773234 ATCCAGGCTGGGCTTGGCCAAGG + Intergenic
1070593712 10:77818189-77818211 AACCTGGGTGGGCCTGGGGAGGG + Intronic
1070830400 10:79414749-79414771 ATCCAGGGTGGGCCTGGCCAAGG - Intronic
1070966986 10:80535973-80535995 AACCTGGGTGTGCCTGGCCTGGG - Intergenic
1072805087 10:98419021-98419043 AGCCTCGGTGGCCCTGGCCATGG + Intronic
1074862730 10:117524551-117524573 ATCCAGCTTGGTCTTGGCCAGGG + Intergenic
1075566304 10:123506984-123507006 ATCCAGGGGAGGGCTGGGCATGG - Intergenic
1075701553 10:124473086-124473108 AGCCAGGGTGGGTCTGGCACAGG + Intronic
1076732722 10:132446555-132446577 CTCAAGGCTGGGCCTCGCCAAGG - Intronic
1076901377 10:133340131-133340153 AGCCAGGGTTGAGCTGGCCAGGG - Intronic
1077048925 11:558094-558116 AGCCAGGCTGGGGCTGGCCTGGG - Intronic
1077076268 11:703594-703616 ACACAGGTGGGGCCTGGCCACGG - Intronic
1077187988 11:1243960-1243982 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077188414 11:1245631-1245653 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077188944 11:1247731-1247753 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077189370 11:1249402-1249424 CACCAGGCTGGGCCTGGGCACGG - Exonic
1077282181 11:1750829-1750851 CTCCAGGGAGAGCATGGCCAGGG - Intronic
1077408402 11:2392683-2392705 ATGCGGGCTGGGCCTTGCCAAGG + Intronic
1077412132 11:2408580-2408602 CTCCAGGGTGTCCCTGCCCAGGG - Intronic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1081464241 11:43301615-43301637 ATCCAATTTGGGTCTGGCCACGG - Intergenic
1082207739 11:49458606-49458628 TTCCAGAGTGGGCATGGCAAAGG - Intergenic
1083265987 11:61547011-61547033 CTCCATGGTCGGCCTGCCCATGG + Intronic
1083487195 11:62990713-62990735 AGGCAGGTTGGGCCTGGTCATGG + Intronic
1083694474 11:64433475-64433497 CTCCAGAGTGAGCCTGGCCATGG + Intergenic
1084256451 11:67946314-67946336 CTCCTGGAGGGGCCTGGCCAGGG - Intergenic
1084653534 11:70502489-70502511 CTCATGGGTGGGCCTGGGCAGGG + Intronic
1085130214 11:74031843-74031865 ATCCAGGATGGGCAAGGCCAGGG + Intronic
1085252635 11:75153600-75153622 ACACAGGGTGAGCATGGCCAGGG + Intronic
1085472638 11:76768007-76768029 GTCCAGGCCTGGCCTGGCCAGGG - Intergenic
1090968303 11:131617454-131617476 ATCTACTGTGTGCCTGGCCATGG + Intronic
1091223402 11:133944140-133944162 TTCCGGGGTGGGCCTGCCCCAGG - Intronic
1091638448 12:2215657-2215679 CTCCAGGGTAGGCCTGGCAGAGG + Intronic
1091741832 12:2964755-2964777 AACCACCGTGCGCCTGGCCATGG + Intronic
1091837520 12:3596088-3596110 GTCCATGGAGGGCCTGGCTAAGG - Intergenic
1091857031 12:3748386-3748408 ATCCTGGATGGGGCTGGCCAAGG - Intronic
1092406385 12:8224557-8224579 ATCCAAGGTGGGCGTGGCTTGGG - Intronic
1092429402 12:8396902-8396924 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1096109753 12:49021601-49021623 GCCCAGGGTGGGCTTGGCCTAGG + Exonic
1096615931 12:52833707-52833729 ATAGAGGGTGGGCTGGGCCAGGG - Intronic
1098138168 12:67424986-67425008 TTCCAGGGTGTGCCTGGGCCTGG + Intergenic
1100997171 12:100314166-100314188 ATCCATGGTTGGCCCGGGCACGG - Intronic
1101966774 12:109287369-109287391 GTCCAGGGTGGGCCGGGTCAGGG - Intronic
1102505981 12:113384891-113384913 ATCCCGGGTGGGCCCAGCCCCGG + Exonic
1102679684 12:114683003-114683025 ATCCATGATCGGCTTGGCCAGGG + Exonic
1104682761 12:130762596-130762618 ATCCAGGTGGGTACTGGCCAAGG + Intergenic
1104822714 12:131687488-131687510 ATGGAGGGTGGGCATGGCCTGGG - Intergenic
1105020981 12:132816755-132816777 AGCCCGGATGGACCTGGCCAGGG - Exonic
1105885324 13:24637089-24637111 CTCCAGGGTGGGCTTTCCCACGG - Intergenic
1106742599 13:32661712-32661734 TTTCAGGATGGGCCTGGACAAGG - Intronic
1107850569 13:44568625-44568647 TTGCAGTGTGGGGCTGGCCATGG - Intronic
1113788387 13:113014915-113014937 CTCCAGCCTGGGCCAGGCCACGG - Intronic
1114031590 14:18584480-18584502 AGCCAGGGTGGGTGTGGCCTGGG - Intergenic
1114612530 14:24052152-24052174 CTCCACGCTGGGCTTGGCCATGG - Exonic
1114660265 14:24339293-24339315 ATCCAGGGAGGTCAAGGCCATGG - Exonic
1117249958 14:53926992-53927014 ATCAAGGGTGTACCAGGCCAAGG + Intergenic
1117601504 14:57380737-57380759 CTTCAGGCTGGGCCTAGCCAGGG + Intergenic
1119389415 14:74280984-74281006 AAGCAGGGTGAGGCTGGCCAGGG - Intergenic
1119643426 14:76330853-76330875 ATGCAGGGTGGGGCTGGCCACGG + Intronic
1121527217 14:94627522-94627544 ATGCAGGCAGGGCCTGGCGAGGG + Intergenic
1122115399 14:99525014-99525036 ATGCGGATTGGGCCTGGCCAGGG - Intronic
1122118698 14:99540608-99540630 ACCCTGGGCTGGCCTGGCCAAGG + Intronic
1122227222 14:100286797-100286819 AACCAGAGGGGGCCTGGCCAGGG - Intergenic
1122411006 14:101526189-101526211 ACCCAGGGTGGGCGAGGCCTAGG + Intergenic
1122816417 14:104316298-104316320 AGCCAGGCTGGGACTGGCCCTGG - Intergenic
1123067767 14:105627005-105627027 ATGCAGGGTGGGGAGGGCCAAGG - Intergenic
1123091450 14:105744006-105744028 ATGCAGGGTGGGGAGGGCCAAGG - Intergenic
1123124406 14:105935904-105935926 ATCCAGATAGGGCATGGCCATGG + Intergenic
1123691014 15:22838465-22838487 ATCCAGGCGGGACCTGGCGAGGG - Intergenic
1124903108 15:33842750-33842772 ATCCAGGTTGGGAGTTGCCAGGG + Intronic
1125479221 15:40069195-40069217 CTCCAGGGCTGGCCGGGCCAGGG - Intergenic
1126065079 15:44820329-44820351 ATCCAGTCTGTGTCTGGCCATGG - Intergenic
1126715008 15:51506351-51506373 ATACAGGCTGGGCATGGGCATGG - Intronic
1127284929 15:57524269-57524291 TTCCAGTGTGGACATGGCCAGGG + Intronic
1128172634 15:65526344-65526366 CTCCAGGGTGGGGCTGGACATGG - Intergenic
1128773523 15:70301607-70301629 GGCCAGGGTGGGGCTGCCCAGGG - Intergenic
1129443312 15:75598375-75598397 ATCCAGGGTGGTCTGGGCTATGG + Exonic
1129975001 15:79814851-79814873 ATACAGGGTGTGCAGGGCCATGG - Intergenic
1132012248 15:98286334-98286356 ATCCAGGCTGGTGGTGGCCAGGG + Intergenic
1132581456 16:686552-686574 CTCCAGGGTGGGCCAGACCCAGG - Intronic
1132599326 16:767016-767038 AGCCAGGGAGTCCCTGGCCAGGG + Intronic
1132906302 16:2284489-2284511 CTCCAGGACGGGCCTGGTCAGGG + Intronic
1133033804 16:3023812-3023834 GACCAGGGTGGGCCTGACCAAGG - Intronic
1133072215 16:3254216-3254238 ATCCGGAGTGGGCCTTGCCCGGG + Exonic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1135577396 16:23596287-23596309 ATCCTGGGTTGGCGTAGCCATGG - Exonic
1135993586 16:27232040-27232062 ATTTAGGGTGGGCCTGTCCCAGG - Intronic
1136411574 16:30080829-30080851 ATCCACTGTGGGCCTGCCCTGGG + Intronic
1137533841 16:49302228-49302250 AGCCAGGGTGAGCCAGGTCAGGG - Intergenic
1138429631 16:56960597-56960619 ACCGAGGGTGCCCCTGGCCAGGG - Intergenic
1139531645 16:67545484-67545506 CTCCATGGTGGGGCTGTCCAAGG - Exonic
1139834542 16:69827739-69827761 AGCCAGGCAGGGCCTGGGCAGGG + Intronic
1140716325 16:77728716-77728738 ATCCAAGGTGGACCCGGACAAGG - Intronic
1141307544 16:82880542-82880564 AACCAGGATGGACCTGGCAAAGG - Intronic
1141569356 16:84924972-84924994 AACCTGGGAGGACCTGGCCACGG - Intergenic
1142141187 16:88473544-88473566 CCCCAGGATGGGCCCGGCCATGG - Intronic
1142362276 16:89633106-89633128 GTCCTGGGTGGGGCTGGGCAGGG - Intronic
1142412036 16:89921818-89921840 GTCAGGGGTGGGGCTGGCCAGGG - Intronic
1142523934 17:524723-524745 ATCAAGTGTGGGCACGGCCATGG + Intronic
1143107311 17:4536183-4536205 CCCCGGGGTGGGGCTGGCCAGGG + Intronic
1143480931 17:7226986-7227008 ATCCATGGTGGCCCTGGCTGCGG + Intronic
1144192741 17:12861273-12861295 AGCCACCGTGTGCCTGGCCATGG + Intronic
1144265206 17:13562142-13562164 AGACAGGGTGGTCATGGCCATGG - Intronic
1144623863 17:16834534-16834556 GCCCAGGGTGGGCGTGGCCTTGG + Intergenic
1144779609 17:17801212-17801234 ATCCAGATGGAGCCTGGCCATGG + Intronic
1144882566 17:18438182-18438204 GCCCAGGGTGGGCGTGGCCTTGG - Intergenic
1145149668 17:20506204-20506226 GCCCAGGGTGGGCGTGGCCTTGG + Intergenic
1146109507 17:30075522-30075544 ATCGAGGGATGGCCTGGCCTGGG - Intronic
1146797030 17:35789077-35789099 TTCCAGAGTGGGCTTTGCCAGGG - Intronic
1146845339 17:36178742-36178764 ACCCAGGGAGGACGTGGCCAGGG - Intronic
1146901442 17:36592008-36592030 CTCCATGCCGGGCCTGGCCATGG - Exonic
1147192507 17:38746354-38746376 AGCGAGGGTGGGCCTGGCTCTGG - Intronic
1147563886 17:41524900-41524922 CTCCAGGTCGGTCCTGGCCAGGG + Exonic
1147581614 17:41630476-41630498 CTCCAGGTTGGCCCCGGCCAGGG + Intergenic
1147636444 17:41967144-41967166 AGCCTGGGTGGGCCTGGGCCGGG + Intronic
1147824430 17:43261393-43261415 TTCCACAGGGGGCCTGGCCACGG - Intergenic
1148733405 17:49851302-49851324 ATCCGGGGTGGGCTGGGGCAGGG + Intergenic
1150198906 17:63332623-63332645 CTCTCGGGTGGCCCTGGCCAGGG - Intronic
1151285413 17:73107587-73107609 AAGCAGGGTGGGCCTTCCCAGGG + Intergenic
1151413589 17:73947366-73947388 ATCCCAGGTGGGACTGGTCAGGG + Intergenic
1152134204 17:78494421-78494443 TGACAGGGTGGGGCTGGCCAGGG + Intronic
1152245323 17:79182359-79182381 AGCCAGGGTGGGTGAGGCCAGGG + Intronic
1152374694 17:79913118-79913140 AGCCAGGGTGGGCGTGGTTATGG - Intergenic
1152739816 17:82013938-82013960 ATCAAAGGTGGGCCTAGCCCAGG - Intronic
1154336788 18:13472155-13472177 ATCCAGCCGGGGCTTGGCCATGG + Intronic
1154502992 18:15005729-15005751 ATCCCGGGTGGGCCCGGCTTGGG - Intergenic
1157124035 18:44938106-44938128 CTCCAGAGTGGTCCTGACCATGG - Intronic
1159015010 18:63094345-63094367 ATCCATGGTGGGCTTGACCTTGG + Intergenic
1159070110 18:63613560-63613582 CACCAGGGTGGGGCTGCCCAAGG - Intergenic
1159586721 18:70289203-70289225 ATCCGGCGCGGGCCGGGCCAGGG + Intronic
1160161743 18:76478763-76478785 ATCCACTGTGGGGCTGGGCATGG + Intronic
1160837463 19:1131619-1131641 AGGCTGGGTGGGCCTGGTCAGGG - Intronic
1160956427 19:1694450-1694472 GTTCAGGCTGGGCGTGGCCAAGG - Intergenic
1161054163 19:2181577-2181599 GGCCAGGGTGGGCCTGACCCAGG + Intronic
1161220650 19:3116574-3116596 AGGTAGGGTGGCCCTGGCCAAGG - Intronic
1161404274 19:4082966-4082988 AGCCAGGCTGGGCCTCTCCAAGG + Intergenic
1161594051 19:5142262-5142284 ATCCAGTGCTGGCCTGGCCCAGG - Intronic
1161619055 19:5288931-5288953 AGACAGGCAGGGCCTGGCCATGG + Intronic
1161888845 19:7019202-7019224 AGCCAGGGAGAGACTGGCCAAGG - Intergenic
1161890523 19:7032819-7032841 AGCCAGGGAGAGACTGGCCAAGG + Exonic
1161890925 19:7037914-7037936 AGCCAGGGAGAGACTGGCCAAGG - Exonic
1161892609 19:7051547-7051569 AGCCAGGGAGAGACTGGCCAAGG + Exonic
1161893008 19:7056375-7056397 AGCCAGGGAGAGACTGGCCAAGG - Exonic
1162140141 19:8580633-8580655 CTCCAGGGTGGGTCTGGGGAGGG - Exonic
1163210887 19:15839370-15839392 ACCCAGGGTGGACCAGACCAGGG + Intergenic
1163725567 19:18921473-18921495 TTCCAGGCTGAGCCTGGCGAGGG + Intronic
1164229609 19:23275915-23275937 AGCCAGGTTGGGCCTGGGGATGG - Intergenic
1164869598 19:31631928-31631950 ACCCAGGGTGGCCCTCGGCATGG - Intergenic
1165758500 19:38307692-38307714 CTCCAGGGTCAGCCAGGCCAGGG + Exonic
1166999456 19:46737368-46737390 ATCTACGCTGTGCCTGGCCAGGG + Intronic
1167359114 19:49020495-49020517 AGCCAGGGTGCCACTGGCCATGG + Intergenic
1167366810 19:49058747-49058769 AGCCAGGGTGCCACTGGCCATGG + Exonic
1168271149 19:55250524-55250546 CTTCAGGGTGGGCCTGGAAATGG - Intronic
925515267 2:4674616-4674638 ATCCAGGGTGTTCCTGCACAAGG - Intergenic
926738152 2:16090055-16090077 ACCCAGGGTGTACCTGGTCAAGG - Intergenic
926738171 2:16090151-16090173 ACCCAGGGTGTACCTGGTCAAGG - Intergenic
926738190 2:16090247-16090269 ACCCAGGGTGTACCTGGTCAAGG - Intergenic
926738209 2:16090343-16090365 ACCCAGGGTGTACCTGGTCAAGG - Intergenic
926849426 2:17178595-17178617 ATCCTGGGTGGGCCTGTCACTGG - Intergenic
927590605 2:24354163-24354185 TTCCAGGATGGGCCTGGTGATGG - Intronic
928166594 2:28976901-28976923 CTCCAGGCTGGGGCTGGCCTTGG + Intronic
928167449 2:28981411-28981433 GGCCAGGGTGGGCCAGGCCTGGG + Exonic
929177160 2:38991567-38991589 CTCAAAGGTGGACCTGGCCAGGG + Intronic
930242962 2:48955241-48955263 ATGCAGGGAGGGCCTAGGCAGGG + Intergenic
935345081 2:102100299-102100321 AGCCAGGCTGGGCATGGACATGG - Intronic
936713795 2:115162043-115162065 CTCCCGGGAGGGCCTGGCCGCGG - Intronic
937029131 2:118723531-118723553 ATCCTGAGTTGGCTTGGCCACGG - Intergenic
937122464 2:119450358-119450380 ATCCAGGGTTGTCCTGGGCTGGG + Intronic
937326448 2:120992313-120992335 ATACAGGTTGGGACTGGCAAGGG - Exonic
938502157 2:131835899-131835921 ATCCCGGGTGGGCCTGGCTTGGG - Intergenic
945041814 2:205748937-205748959 AGCCAGGTTTGGCCTAGCCAGGG + Intronic
946400955 2:219468278-219468300 ATCCAGGGTGGGCAGGGTGAGGG + Intronic
947700808 2:232232436-232232458 AGCCATGGTGGTCTTGGCCAAGG + Intronic
948140830 2:235670665-235670687 CTCCAGGGTGGTCCCGGCCGCGG - Intronic
948254508 2:236556253-236556275 AGCCAGGGTGGCGCTTGCCACGG + Intergenic
948368235 2:237472474-237472496 AGCCAGGGTGGCTCTGCCCAAGG + Intergenic
1170597836 20:17818849-17818871 ATCCAGGGTTGGGCTGGGCATGG + Intergenic
1170850367 20:19998821-19998843 ATCCAGGGAGGGGCTGCCTAGGG + Intronic
1171291610 20:23985819-23985841 GTGCAGGGTGGGCACGGCCAGGG + Intronic
1171403353 20:24893210-24893232 ATCCAAGGTGGGGCTGGAAATGG + Intergenic
1171427207 20:25056848-25056870 ATGCAGGGTGGGCCTGGGTGTGG - Intronic
1172225259 20:33301291-33301313 GTCCAGGGTGGGCATTGTCAGGG - Exonic
1172647920 20:36483078-36483100 GTCCAGGGTGGGCTGGGGCAGGG + Intronic
1173385828 20:42587125-42587147 ATCCAGGGTGGACATGGCAGAGG + Intronic
1174461964 20:50689677-50689699 ATCCAGGGTGGAACTGGGTAGGG + Intronic
1175858333 20:62134750-62134772 GTCAAGGTTGGGGCTGGCCAGGG + Exonic
1175984994 20:62760287-62760309 GTCCAGGAGGAGCCTGGCCATGG + Exonic
1176111155 20:63411388-63411410 AGCCAGGAGGGGCCTGTCCAGGG + Intronic
1176177494 20:63735598-63735620 ACCCAGGGTGGCCCTGCCCCCGG + Intronic
1176866137 21:14056183-14056205 ATCCAGGGCTGGCCCTGCCATGG - Intergenic
1179590274 21:42403550-42403572 ATCCAGGGTGGGTCAGGGCAGGG + Intergenic
1180019897 21:45116246-45116268 CCCCAGGGTGGGGCTGGCCTGGG + Intronic
1180087538 21:45514675-45514697 ATTCAGGGCCGGCCTGGCCTGGG - Exonic
1180225643 21:46390540-46390562 ACCCAGGCAGGGCCAGGCCAGGG - Intronic
1180455702 22:15511537-15511559 AGCCAGGGTGGGTGTGGCCTGGG - Intergenic
1181162679 22:20967322-20967344 AGCCAGGGTGGGGCTGGGCTAGG + Intronic
1181400338 22:22647116-22647138 GTGCAGGGTGGGCACGGCCAGGG - Intronic
1181649027 22:24248675-24248697 GTGCAGGGTGGGCACGGCCAGGG + Intergenic
1181702317 22:24628214-24628236 GTGCAGGGTGGGCACGGCCAGGG - Intronic
1181939567 22:26464700-26464722 ATCTGGGGTGGTCCAGGCCATGG + Exonic
1182077760 22:27506516-27506538 ATCCAGGGTTGGCCTGCACCAGG - Intergenic
1182490335 22:30667671-30667693 AGCCAGGGTGGGGCTGCTCAGGG - Exonic
1182620513 22:31616103-31616125 AGCCTGGGTGGGGATGGCCAGGG + Intronic
1182622816 22:31627190-31627212 ATCCAGGCTGGGGCTGGTCCAGG + Intronic
1184155233 22:42662675-42662697 ATCCAGAGGGCGCCTGGACAAGG - Intergenic
1184230462 22:43155849-43155871 AGCTGGGGTGGGCCAGGCCAGGG - Intronic
1184411282 22:44327798-44327820 AACCAGGGTGGGCAGGGCCTCGG + Intergenic
1185041133 22:48504956-48504978 ATCCACAGTGGGCCTGAGCAGGG - Intronic
1185316373 22:50180956-50180978 CTCCAGGAGGGGCCTGGCGATGG - Intergenic
1185348449 22:50320964-50320986 ACCCAGGGTTGGCCACGCCAAGG + Intronic
949482972 3:4511451-4511473 TTCCAGGGTGGCTTTGGCCAAGG - Intronic
950007397 3:9700229-9700251 TTCCAGGGAGGGACTGTCCAGGG + Intronic
950101129 3:10357668-10357690 ACCCAGCCAGGGCCTGGCCAGGG + Intronic
950158840 3:10743789-10743811 ATCCTGGCAGGGCCGGGCCATGG - Intergenic
950749889 3:15120256-15120278 AACCAGGCTGAGCCTGCCCAGGG + Intergenic
952341626 3:32452169-32452191 CTCCAGGTTGGGCCAGGTCAGGG - Intronic
952953449 3:38542469-38542491 ATCCTTGGTGCGACTGGCCAGGG - Intergenic
953033720 3:39193711-39193733 GTCCTAGGTGGGCCTGGCCCAGG + Intergenic
953608011 3:44424485-44424507 ATTCAAGGTGGGCCTGGGCTGGG - Intergenic
954150633 3:48655467-48655489 ATCCAGGGTGGCCCTGGGAATGG - Intronic
955822640 3:62912373-62912395 ATCGTGGGTGGGACTGGACAAGG + Intergenic
957253121 3:77799954-77799976 ATCCAGGCTGGGCATGACAAAGG + Intergenic
959694148 3:109231678-109231700 ATGCGGGGTGGGGCAGGCCAAGG - Intergenic
961215429 3:125156254-125156276 ATCATGGATGGGGCTGGCCAAGG + Intronic
961365885 3:126398951-126398973 AACCAGGCCTGGCCTGGCCAGGG - Intronic
961508738 3:127388475-127388497 CCCCAGCCTGGGCCTGGCCAAGG + Intergenic
961650925 3:128416313-128416335 CTGCAGGGTGGGCCAGGCCGGGG - Intergenic
962870037 3:139480771-139480793 AGCCTGGGTGGGCCTGGGCCTGG - Intergenic
963956177 3:151256456-151256478 AGACAGGGTGGGACTGGCAATGG - Intronic
965111864 3:164435376-164435398 ATCCAGGCTGGGCATGGTCTTGG + Intergenic
968441492 4:626674-626696 GTCCAGGGTGGGACTGGGGAGGG + Intronic
968491459 4:892630-892652 GTCAGGGCTGGGCCTGGCCAGGG - Intronic
968521197 4:1035537-1035559 TACGAGGGTCGGCCTGGCCAGGG + Intergenic
968628366 4:1637993-1638015 ACCCACGGTGGGCCTGGACTTGG - Intronic
968897910 4:3415561-3415583 AGCCAGGCCGGGCCAGGCCAAGG - Intronic
969014966 4:4098003-4098025 CTCCTGGAGGGGCCTGGCCAGGG - Intergenic
969016625 4:4107758-4107780 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
969287077 4:6209494-6209516 GAACAGGGTGGGTCTGGCCAAGG + Intergenic
969462992 4:7338564-7338586 AGCCAGGGTGGGGCTGGCTAAGG + Intronic
969489603 4:7491551-7491573 ATCCAGAGAGGTCCTAGCCAAGG - Intronic
969718002 4:8877690-8877712 ATCCCGGGTGGGCCTTCCCTGGG - Intergenic
969759750 4:9173426-9173448 ATCCAAGGTGGGCGTGGCTTGGG + Intronic
970615206 4:17762393-17762415 ATCTAGGCTGGGCATGGCTAAGG + Intronic
974057865 4:57002317-57002339 CTCCAGGTCGGGCCTGGACACGG - Intronic
974231078 4:59114465-59114487 ATCCAGGATGGGCCTGTTAAGGG - Intergenic
978546861 4:109879656-109879678 CTCCAGGTCGGTCCTGGCCAGGG + Intergenic
979867829 4:125778048-125778070 ATGCAGGGTGGAGCTGGCAATGG - Intergenic
980991883 4:139745223-139745245 TCACAGGGTGGGACTGGCCATGG + Intronic
984252091 4:177347354-177347376 ATGCAGAGTCGGCTTGGCCAAGG + Intronic
984700105 4:182813781-182813803 GTCCAGGGTGGGCCAGGGCCGGG + Intergenic
985756809 5:1724317-1724339 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985756824 5:1724364-1724386 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985756839 5:1724411-1724433 GTGCAGGGTGGGCATGGCCGAGG - Intergenic
985759332 5:1737111-1737133 ATCCACTGTGGGCCCAGCCAAGG + Intergenic
986552477 5:8974049-8974071 ATCCAGGCTGGTGTTGGCCATGG + Intergenic
990017007 5:51075672-51075694 AGCCAGGGTGGCCCTAGCTAAGG + Intergenic
990560129 5:56975404-56975426 AGTCTGGGTGTGCCTGGCCATGG - Intergenic
993111108 5:83658399-83658421 ATACAGCTTGGGCCTGGCTATGG + Intronic
996502234 5:124230080-124230102 ATCGGGGGTGGGGCAGGCCATGG - Intergenic
996856778 5:128017049-128017071 ATCCAGGGTCTTCCTGGCCCTGG + Intergenic
997198508 5:131995354-131995376 ATCAAGGGTGGGCCAGGTGATGG + Intronic
997372532 5:133371031-133371053 AACCAGGCTGGTACTGGCCAGGG - Intronic
997588737 5:135060226-135060248 ATGGAGAGTGGGCCTGCCCAGGG + Intronic
998093556 5:139384374-139384396 CTTCAGGCAGGGCCTGGCCATGG - Intronic
998507912 5:142686759-142686781 ATCCAGGTTGGGACTGGCGAGGG + Intronic
999302256 5:150498569-150498591 AGCCAGGGAGGGCCTGGGCTAGG - Intronic
999972247 5:156876419-156876441 AATCAGGGTGGGGCTGGCTATGG - Intergenic
1000154597 5:158538466-158538488 GTCCAGGGTGTGCCTGGGAAAGG - Intergenic
1001424357 5:171613753-171613775 ATCCATGCAGTGCCTGGCCATGG - Intergenic
1001522234 5:172403015-172403037 CACCAGGGAGGCCCTGGCCAAGG - Intronic
1001592280 5:172873649-172873671 CTCCAGGATGAGGCTGGCCAGGG + Intronic
1001809788 5:174618869-174618891 AAACAGGCTGGGCCTGGGCAGGG + Intergenic
1003484084 6:6560462-6560484 ATACAGGGTGGGGTTGGCAAAGG - Intergenic
1003510051 6:6772149-6772171 ATCCAGGGAGGGTCTGGTCCAGG + Intergenic
1003965475 6:11248682-11248704 ATTCTGGATGGGCCTGGCCTTGG - Intronic
1004208931 6:13617890-13617912 AGCCAGCATGGGCCTGGCCAAGG + Intronic
1004312106 6:14554856-14554878 ATACAGGGTGGGCTTCTCCAGGG - Intergenic
1004423995 6:15495446-15495468 ATCCAGCCTGGCCCTGTCCAGGG + Intronic
1006425320 6:33959700-33959722 ATCCAGGTAGGGCCAGGCCGAGG - Intergenic
1006447753 6:34089474-34089496 ATCCTACGGGGGCCTGGCCAGGG - Intronic
1006449854 6:34099593-34099615 ATCAGGGATGGGCCTGGTCAGGG - Intronic
1006826210 6:36938140-36938162 AACAAGAGTAGGCCTGGCCAGGG - Intergenic
1006914897 6:37587865-37587887 ATCCCGGGAGTGACTGGCCAGGG - Intergenic
1007743182 6:44025144-44025166 AACTAGGGTGGGCCTAGACATGG - Intergenic
1007790397 6:44305199-44305221 CTGCAGGGTGGGCATGGGCATGG + Intronic
1008808132 6:55456711-55456733 AACCATGCTGGGCCTGTCCATGG - Intronic
1009325130 6:62339381-62339403 CTCCAGGGTTGGCCTGGAAAAGG + Intergenic
1017722203 6:157251532-157251554 AGACAGGGTGGGCCTGGGCGCGG - Intergenic
1018092352 6:160356088-160356110 TTCCAGGGTTGGCCTAGCCATGG - Intronic
1019287494 7:231069-231091 GGCCAGGGTGGTCCAGGCCAGGG + Intronic
1019526442 7:1482518-1482540 GTCCAGGCTGGGCTTGGGCAGGG - Intronic
1019615180 7:1956212-1956234 GTCCAGGGTGGCCCTGGGGAAGG - Intronic
1019730714 7:2627896-2627918 ATCTAGTGTGGGCCAGGGCATGG - Intergenic
1021361101 7:19713162-19713184 ATCCAGGGTGGGCATTCCTAGGG - Intergenic
1023468764 7:40490059-40490081 AGCCTGGGTGGCACTGGCCATGG - Intronic
1024176775 7:46848315-46848337 ATCCAGGCAGTGCCTGGACAAGG + Intergenic
1026858666 7:73770686-73770708 GACCAGGGTGGGCGTGGCCGCGG + Intergenic
1028449225 7:90962194-90962216 ATCTAGTGTGGGGCTGGGCATGG + Intronic
1028465667 7:91148678-91148700 CTCCTGGGTGTGCCTGACCATGG - Intronic
1029075100 7:97928558-97928580 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1029283272 7:99450217-99450239 AGCCAAGGTGGGCCTGGCCCCGG + Intronic
1030669954 7:112325223-112325245 ATCCTGGGTAGTCCTGGCTAAGG + Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032268039 7:130381935-130381957 ACCCAGGCTGGCCCTGGCCTTGG - Intronic
1033210571 7:139457215-139457237 GCCCAGGGTGGGGCTGGGCAGGG + Intronic
1034278103 7:149832912-149832934 TGCCAGGGTGGGTCTGGGCAGGG + Intergenic
1035383836 7:158457510-158457532 CTCCAGGGCGAGCCTGGCCTGGG + Intronic
1035383870 7:158457667-158457689 CTCCAGGGCGAGCCTGGCCTGGG + Intronic
1035383906 7:158457824-158457846 CTCCAGGGCGAGCCTGGCCTGGG + Intronic
1035478085 7:159157924-159157946 GTCCAGCCTGGGGCTGGCCACGG + Intergenic
1036242431 8:7091820-7091842 GGCCAGAGCGGGCCTGGCCACGG + Intergenic
1036256742 8:7212431-7212453 TTCCTGGAAGGGCCTGGCCAGGG - Intergenic
1036263343 8:7257157-7257179 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036264646 8:7264779-7264801 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036265945 8:7272401-7272423 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036267247 8:7280023-7280045 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036268550 8:7287645-7287667 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036269854 8:7295267-7295289 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036280207 8:7393809-7393831 AGCCAGGATGAGCCAGGCCAAGG + Intergenic
1036298039 8:7551787-7551809 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036299344 8:7559436-7559458 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036300649 8:7567085-7567107 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036301954 8:7574730-7574752 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036303252 8:7582379-7582401 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036308792 8:7671033-7671055 TTCCTGGAAGGGCCTGGCCAGGG - Intergenic
1036315387 8:7715696-7715718 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036316691 8:7723344-7723366 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036317998 8:7730992-7731014 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036319305 8:7738640-7738662 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036320614 8:7746287-7746309 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036321924 8:7753935-7753957 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036323233 8:7761583-7761605 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036324532 8:7769230-7769252 ATCCAAGGTGGGCGTGGCTTGGG + Intergenic
1036341318 8:7918074-7918096 AGCCAGGATGAGCCAGGCCAAGG - Intergenic
1036351502 8:8015077-8015099 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036352810 8:8022723-8022745 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036354099 8:8030371-8030393 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036360749 8:8075078-8075100 TTCCTGGAAGGGCCTGGCCAGGG + Intergenic
1036846760 8:12175496-12175518 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036868125 8:12417815-12417837 ATCCAAGGTGGGCGTGGCTTGGG - Intergenic
1036890219 8:12591894-12591916 TTCCTGGAAGGGCCTGGCCAGGG - Intergenic
1036899386 8:12659610-12659632 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1036900453 8:12665757-12665779 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1037835753 8:22213902-22213924 GTCCAGGGTAGGCCCAGCCAGGG + Intergenic
1037904905 8:22710542-22710564 TTCCAGGGATCGCCTGGCCAGGG + Intergenic
1038613640 8:29074136-29074158 ATCCTGGGAGAGCCTGGCCTGGG - Intronic
1039890667 8:41683430-41683452 GTCCCAGGTGGGCCTGGGCACGG - Intronic
1040543129 8:48377094-48377116 GTCCCGGGTGACCCTGGCCAGGG - Intergenic
1047521446 8:125598369-125598391 TTCCAGGCTGTGCCTGGGCAGGG - Intergenic
1047566241 8:126047101-126047123 ATGCAGGGTGGGGCGGGTCAGGG - Intergenic
1049178394 8:141207753-141207775 ACCCAAGGAGGGGCTGGCCAAGG + Intronic
1049345569 8:142136792-142136814 CTCCAGGGAGGTCCTGGCCCTGG - Intergenic
1049420126 8:142512789-142512811 CTCCAGAGTGGGCCTGGCTTAGG + Intronic
1049673359 8:143879223-143879245 ATCCCAGGTGGGCAGGGCCACGG + Intergenic
1049767381 8:144361155-144361177 TTCCAGGGTGGGCAAGGGCAAGG + Exonic
1049799544 8:144511457-144511479 TGCCCTGGTGGGCCTGGCCACGG - Exonic
1053052864 9:34976394-34976416 AGCCTGGGTGACCCTGGCCATGG + Intronic
1053368510 9:37541376-37541398 ATACAGGCTGGCCATGGCCAAGG + Exonic
1053369915 9:37552168-37552190 ATTAAGGGTGGTTCTGGCCAGGG - Intronic
1055594154 9:77848570-77848592 TTCCAGAGTTGGCTTGGCCAGGG + Intronic
1055766837 9:79672402-79672424 AGCCAGGGTGGGTCTGGCAAAGG + Intronic
1056958215 9:91099464-91099486 CTCCTGGATGGGCCTGGCCCCGG - Intergenic
1057038084 9:91826119-91826141 ATCCTGGGTAGCCCTGGCCAAGG - Intronic
1057129055 9:92640660-92640682 TTTCAGGGTGGGGCTGGCAAAGG - Intronic
1060044626 9:120330037-120330059 CTCCATGGTGGGCCTTGCAAGGG - Intergenic
1060263038 9:122092726-122092748 ATCCAGGGAGGTCCTGGCCTTGG + Exonic
1060960344 9:127676381-127676403 ATTCAGGGTGGGGGTGGGCAGGG + Intronic
1061951005 9:133935803-133935825 CTTCAGCGTGGGCCTGGCCTCGG - Intronic
1062094931 9:134698244-134698266 GCCCCAGGTGGGCCTGGCCAAGG - Intronic
1062160553 9:135077290-135077312 ATTCTGGGTGGTCCTGGACATGG + Intronic
1062355012 9:136157834-136157856 ACCCAGGGTGGGCTTGGCTTTGG + Intergenic
1062454179 9:136627958-136627980 AGGCAGGGTGGGCCCGGCCAAGG + Intergenic
1062463785 9:136672493-136672515 AGCCAGGGTGGGGGTAGCCAGGG - Exonic
1062497285 9:136837780-136837802 ATCCCGGGTGGGCCTGGCTTGGG + Intronic
1062619872 9:137415731-137415753 ATCAAGGGTGGGCTTTCCCAAGG + Intronic
1062702759 9:137916631-137916653 GTCCAGCTTGGGACTGGCCAAGG + Intronic
1190218448 X:48495489-48495511 ACCCCAGGTGGTCCTGGCCAGGG + Intergenic
1190430220 X:50371640-50371662 TTCCAGTGTGGGCCAGGACATGG - Intronic
1195162394 X:102183388-102183410 ATGCAGAGTGGGCCTGGCAGAGG - Intergenic
1195166433 X:102224985-102225007 ATGCAGAGTGGGCCTGGCAGAGG - Intronic
1195192427 X:102462103-102462125 ATGCAGAGTGGGCCTGGCAGAGG + Intronic
1197776519 X:130121787-130121809 ATTCAGGGAGTGCCTGCCCAAGG + Intergenic
1200118776 X:153780849-153780871 CTCCAGGGTGGGCCTGGAGCAGG + Intronic
1200235257 X:154464957-154464979 CTCCAGGTTGGGCCTGGAGAAGG + Intronic
1200243944 X:154512852-154512874 CTCCTGGGTGGGCCTGGCAGTGG - Exonic