ID: 1070830559

View in Genome Browser
Species Human (GRCh38)
Location 10:79415605-79415627
Sequence TGAGGGGGTACCCTCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830559_1070830574 25 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA No data
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data
1070830559_1070830565 1 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA No data
Right 1070830565 10:79415629-79415651 TCCTCCCTGCACCCTCTCCCAGG No data
1070830559_1070830569 10 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA No data
Right 1070830569 10:79415638-79415660 CACCCTCTCCCAGGTCTGAAAGG No data
1070830559_1070830575 28 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA No data
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830559 Original CRISPR TGAGGGGGTACCCTCAGCCT GGG (reversed) Intronic