ID: 1070830559

View in Genome Browser
Species Human (GRCh38)
Location 10:79415605-79415627
Sequence TGAGGGGGTACCCTCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830559_1070830575 28 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830559_1070830569 10 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1070830569 10:79415638-79415660 CACCCTCTCCCAGGTCTGAAAGG No data
1070830559_1070830574 25 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data
1070830559_1070830565 1 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1070830565 10:79415629-79415651 TCCTCCCTGCACCCTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830559 Original CRISPR TGAGGGGGTACCCTCAGCCT GGG (reversed) Intronic
900403463 1:2482416-2482438 TGAGTGGGCACCCCCAGACTTGG + Intronic
901057847 1:6457117-6457139 ATAGGGGGCACCCTCAACCTCGG - Intronic
901138714 1:7014147-7014169 TCAGAGGGTGCCCTCAGCCGTGG + Intronic
901149650 1:7092806-7092828 AGAGGGGGCTTCCTCAGCCTAGG - Intronic
902476503 1:16691339-16691361 ATAGGGGGCACCCTCAACCTGGG + Intergenic
902796943 1:18806243-18806265 TGAGGAGGGACCCTTAACCTGGG + Intergenic
903847205 1:26285562-26285584 TGAGGGGGTGGCCTGGGCCTTGG + Intronic
904386579 1:30146383-30146405 GGAGGGGGGACCCTGGGCCTTGG + Intergenic
904871080 1:33618716-33618738 TGAGGGGATACCCTCACCAATGG - Intronic
905172287 1:36116338-36116360 AGAAGGGGCATCCTCAGCCTGGG - Intronic
905484589 1:38286319-38286341 TGAGGAGGTGCCCACAGGCTTGG + Intergenic
906975929 1:50573146-50573168 TGAGATGGTGCCATCAGCCTGGG - Intronic
908528841 1:65013683-65013705 TGAGAAGTTACCCTCATCCTGGG + Intergenic
918051658 1:180978476-180978498 TGTGGGGGTCCCCTTCGCCTGGG - Intronic
921004991 1:211084529-211084551 TGAGGGGCTATCCTGAGTCTAGG - Intronic
924749493 1:246872537-246872559 TTAGGGGGTGTCCTCTGCCTTGG + Intronic
924760803 1:246983426-246983448 TGAGAGGATAACCTGAGCCTGGG + Intronic
1070830559 10:79415605-79415627 TGAGGGGGTACCCTCAGCCTGGG - Intronic
1071525333 10:86354972-86354994 TGAGCAGGTTCCCACAGCCTTGG - Intronic
1073352595 10:102830702-102830724 TTAGGTGCTACCCTCAGCCTGGG + Exonic
1074559222 10:114520087-114520109 TGAGGGTGTACCCTCTGCAGTGG - Intronic
1076577537 10:131479782-131479804 TGAGAGGGTCACCTGAGCCTGGG - Intergenic
1077025408 11:437825-437847 AGAGGAGGGACCCTCATCCTGGG - Intronic
1077439114 11:2560039-2560061 GGAGGGGGTACCGCCAGCCTGGG + Intronic
1077536873 11:3128774-3128796 GGAGGGGGTTCCCACAGCCCAGG - Intronic
1079602200 11:22323583-22323605 TGAGGTGGGTCCCTCTGCCTGGG - Intergenic
1080262839 11:30368361-30368383 TGAGGTGGTACCTTCTGCCACGG + Intergenic
1083457877 11:62791199-62791221 TGAAGGGCAGCCCTCAGCCTAGG + Intronic
1083659631 11:64246139-64246161 TCAAGGGGTAGCCTGAGCCTTGG - Intronic
1083749573 11:64753823-64753845 TGAGGGGGGACACCCAGTCTGGG - Intronic
1084103129 11:66963240-66963262 TGAGGGGCTGCCCTAAGGCTAGG + Intergenic
1084156078 11:67313275-67313297 TGAGAGGGTCTCTTCAGCCTGGG - Intergenic
1086406798 11:86505562-86505584 TGAGGGGGCTCCCTTAACCTGGG - Intronic
1090429647 11:126635274-126635296 GGAGGGGTTACCTTCTGCCTTGG - Intronic
1091583085 12:1800476-1800498 GGGGGGGGCACCCTCACCCTTGG - Intronic
1091743094 12:2973955-2973977 TGGGATGGTAACCTCAGCCTAGG + Intronic
1096504844 12:52086234-52086256 TGAGAGGGGACCTGCAGCCTGGG + Intergenic
1096714488 12:53482942-53482964 AGGAGGGGGACCCTCAGCCTGGG - Exonic
1103535035 12:121628095-121628117 TCTGGGGATACCCTCAGGCTTGG + Intronic
1104893919 12:132152757-132152779 TGGGGGGGTTCTCTCTGCCTGGG + Intergenic
1108863278 13:54889667-54889689 TGAGAGGGTCACCTCAGACTGGG - Intergenic
1109554514 13:63954875-63954897 CTAGGGGGTACCCTAAGCCCAGG + Intergenic
1109718409 13:66246461-66246483 AGAGGGGGCTCCCACAGCCTTGG - Intergenic
1110955685 13:81549833-81549855 GGAGGAGGTACCCTAGGCCTTGG - Intergenic
1112565035 13:100545427-100545449 TGAGGGGGTGCCCTCCTCCAGGG - Intronic
1118309927 14:64684594-64684616 TGAATGTGTACCCGCAGCCTGGG - Intergenic
1118839919 14:69502388-69502410 TGAGGGTTTGCCTTCAGCCTGGG + Intronic
1121208762 14:92190741-92190763 TGAGGGGATACCCTCACCTAAGG - Intergenic
1121335052 14:93072785-93072807 TGGGGGGGAACCCTCAGACGAGG + Intronic
1121524662 14:94611414-94611436 TGTGGGGGCCTCCTCAGCCTTGG - Intronic
1122241677 14:100372520-100372542 TGCCGGAGTACCCTCTGCCTAGG + Intronic
1122314168 14:100815848-100815870 TCAGGGGGGATCTTCAGCCTAGG + Intergenic
1123040486 14:105488290-105488312 TGAGGGGGTGCCATCACCCCTGG - Intronic
1124018891 15:25902321-25902343 TGAGTGGGTGCCTTCAGCTTGGG + Intergenic
1126933024 15:53676025-53676047 AGTGAGGGTACCCTGAGCCTTGG - Intronic
1127299607 15:57639827-57639849 TGAGTGGGTACCCACAGCTCAGG + Intronic
1127883498 15:63178660-63178682 TGAGAGGATACCTTGAGCCTGGG + Intergenic
1128089851 15:64911997-64912019 TGCGGGGGTCCTCTCGGCCTCGG - Intronic
1129263890 15:74383722-74383744 TGTGGTGGAACCATCAGCCTGGG - Intergenic
1131056105 15:89376065-89376087 TGGGTGGGTACCATCAGACTTGG - Intergenic
1132028326 15:98421104-98421126 TGAGGGGGCTGCCCCAGCCTGGG - Intergenic
1132167761 15:99612621-99612643 TGAGAGGGTTCCTTGAGCCTAGG + Intronic
1132786073 16:1657651-1657673 TGTGGGTGGACCCTGAGCCTAGG + Intronic
1133275186 16:4634099-4634121 GGAGGGGCTACCATCAGCCCAGG - Intronic
1133838286 16:9385843-9385865 GGGTGGGGGACCCTCAGCCTGGG + Intergenic
1134121652 16:11588083-11588105 TGACGGGCCACCCTCAGCCGTGG + Intronic
1137230547 16:46561884-46561906 TGAGCTAGTACACTCAGCCTGGG - Intergenic
1138290879 16:55845921-55845943 TGACGGGGTATCCTCAGCCATGG - Intergenic
1138651805 16:58464956-58464978 TGACTGGGGACCCTCAGCCTTGG + Intronic
1139894468 16:70277310-70277332 TGAGAGGCTACCCTCTGCTTTGG - Intronic
1143210861 17:5186302-5186324 TCAGAGGGTGCCCTAAGCCTTGG - Intronic
1144749541 17:17638899-17638921 TGAGAGGATTCCCTGAGCCTGGG + Intergenic
1146136584 17:30327206-30327228 TAAGAGGGTTCCATCAGCCTGGG + Intronic
1146551311 17:33782634-33782656 TGAGAGGGTTGCCTGAGCCTGGG + Intronic
1146721750 17:35129028-35129050 TCAGGTGGTACCCTGAGCCGTGG + Intronic
1148559767 17:48599139-48599161 TGAGGGGTATCCCTCAGCCTAGG + Intronic
1152537990 17:80961364-80961386 GGAGGGGGCACGCTCAGCGTGGG - Intronic
1152595612 17:81236288-81236310 AGAAGGGGAACCCACAGCCTGGG + Intronic
1152964061 18:98292-98314 TGAGGGGGTCCCACAAGCCTAGG - Intergenic
1155464403 18:26119832-26119854 TGAGGGGGTCTCCTCATCCAAGG - Intergenic
1157396409 18:47345476-47345498 TGGGCAGGTTCCCTCAGCCTGGG + Intergenic
1159447839 18:68561892-68561914 AGAGGAGGTTCCATCAGCCTAGG + Intergenic
1159794573 18:72826743-72826765 TGTGGGGGAACACTCACCCTAGG - Intronic
1160910481 19:1471640-1471662 TGAGCGTGTGCCTTCAGCCTGGG - Exonic
1160935018 19:1590523-1590545 TGAGAGGGTCGCCTGAGCCTGGG + Intronic
1161201210 19:3015831-3015853 TGGTGGGGGACCCTCAGTCTCGG - Intronic
1164682578 19:30145472-30145494 GGAGTGGGTACCTTCTGCCTGGG + Intergenic
1165758388 19:38307240-38307262 AGAGGGGGTATCCTGAGCCCTGG - Intronic
1166285172 19:41821300-41821322 CTAGGGGGTACCCTAAGCCCAGG - Intergenic
1167768521 19:51499838-51499860 TGAGGTGGGACCCCCATCCTGGG - Intronic
1202710522 1_KI270714v1_random:17180-17202 ATAGGGGGCACCCTCAACCTGGG + Intergenic
925427834 2:3765560-3765582 TAAGGAGGTAGCCACAGCCTTGG - Intronic
930538014 2:52667807-52667829 TGAGGAAGTAACCTCTGCCTAGG + Intergenic
932137317 2:69242626-69242648 TGAAGGGAAACCCTCATCCTGGG - Intronic
932650872 2:73554701-73554723 TCAGGTGTTACCCTCAGCATGGG + Intronic
935644707 2:105324784-105324806 TGAGGGTGGACACTCAGGCTGGG + Intronic
938014460 2:127856194-127856216 TGAGAGGATAACCTGAGCCTAGG + Intronic
947649698 2:231775400-231775422 TGAGGGGATCACCTGAGCCTGGG - Intronic
1168828569 20:831291-831313 TGAGCAGGTAGCTTCAGCCTAGG - Intergenic
1172646362 20:36472785-36472807 TCAGAGTGTCCCCTCAGCCTGGG - Intronic
1172905144 20:38363761-38363783 TGGGGGTGTATGCTCAGCCTAGG - Intronic
1172938239 20:38636353-38636375 TGAGAGGGTCACCTGAGCCTGGG - Intronic
1177684167 21:24416032-24416054 TGAGGGTGTATCCTAGGCCTTGG + Intergenic
1178302541 21:31465103-31465125 TGAGAGGATTCCCTCAACCTGGG + Intronic
1180257669 21:46643830-46643852 GGAGTGGGGACCCTCAGCCAGGG + Intronic
1182512013 22:30826515-30826537 GGAGGGGGCACCTCCAGCCTTGG - Intronic
1183258783 22:36780826-36780848 AGATGGGGTAACCTCATCCTGGG + Intergenic
1183983401 22:41555698-41555720 TGAGGGGGTTCCCCCAGCTGAGG - Intergenic
1184045799 22:41971609-41971631 TGAGGGGGGACCCTCCTCCAGGG - Intergenic
950334570 3:12183131-12183153 TTAAAGGGGACCCTCAGCCTCGG - Intronic
950451585 3:13068479-13068501 TGAGGGGGTGTCATGAGCCTGGG - Intronic
950714260 3:14836614-14836636 TGAGGGGGTTCAGACAGCCTGGG - Intronic
950995839 3:17494910-17494932 TGAGGGGATACCCTGATCCCTGG + Intronic
951841098 3:27035083-27035105 TGAGGTGGTTCACTCAGCCAAGG + Intergenic
953588567 3:44228828-44228850 TGAGGTGGGAGCCTGAGCCTAGG - Intergenic
954249726 3:49358392-49358414 TGAGGCGGGACCCTCAGGCCCGG - Exonic
954288025 3:49632871-49632893 TGGGAGGGTATCCTGAGCCTAGG + Intronic
954634127 3:52062419-52062441 TGAGGGGGGACCCCATGCCTGGG - Intergenic
954710959 3:52504878-52504900 TGAGGGAGGAGCCTCAGCCTGGG + Intronic
955284411 3:57624990-57625012 TGAGGGGATGGCCTCAGCCTAGG - Intergenic
955467065 3:59248433-59248455 GGAGAGGGTACCCTCAGACAGGG + Intergenic
960056240 3:113278522-113278544 TGAGGGTGTGGGCTCAGCCTCGG - Intronic
960588864 3:119346148-119346170 GGAGTGGGTAGCCTCAGGCTAGG - Intronic
961831867 3:129627105-129627127 TGGGGGTGTACCCGCAGCCGGGG - Intergenic
967058466 3:185850628-185850650 TGAGGTGGTAATCTCAGGCTGGG - Intergenic
968815917 4:2821650-2821672 TGAGGGGATCACCTGAGCCTGGG - Intronic
969697041 4:8740820-8740842 TGAGGGTGCAGCCCCAGCCTGGG - Intergenic
970892180 4:21059432-21059454 TGCTGGGGAACCCTCAGCCATGG + Intronic
971342485 4:25783271-25783293 TCAGGGGGTTCCCTCTTCCTGGG + Intronic
972518714 4:39833479-39833501 TGAGGGGATCACCTGAGCCTGGG - Intronic
973650998 4:52997120-52997142 TGGAGAGGTACCCTCAGTCTGGG - Intronic
977441147 4:97070039-97070061 TGAGGGGGTAGCCTTTGCCAGGG - Intergenic
977471419 4:97447972-97447994 GGAGGGGGCTCCCACAGCCTTGG - Intronic
982563628 4:156962281-156962303 TCAGGCTGTTCCCTCAGCCTAGG + Intronic
990848137 5:60168057-60168079 TTAAGGGGTACTCTTAGCCTGGG + Intronic
992015543 5:72572038-72572060 TGAGGGGATCCCCTGAGACTGGG - Intergenic
1000325248 5:160167114-160167136 AGAGGGGGAACCCTCAGCTCCGG - Intergenic
1001690623 5:173629941-173629963 TGAGAGGGTGGACTCAGCCTGGG - Intergenic
1002299235 5:178248120-178248142 TGGGTGGGGACCCTGAGCCTTGG - Intronic
1002915078 6:1522586-1522608 TGAGAGGGAACCCACAGGCTGGG - Intergenic
1007632409 6:43279954-43279976 TGCTAGGGTCCCCTCAGCCTGGG - Intronic
1007633505 6:43285252-43285274 GGAGGGGGTGCCATCAGGCTGGG - Exonic
1008767252 6:54933887-54933909 TGAGGGAGGACCCCCAGTCTGGG + Intronic
1009725595 6:67532605-67532627 GGAGGGGGTGCCCTCTCCCTTGG + Intergenic
1012153023 6:95779497-95779519 TGAGAGGATGCCTTCAGCCTGGG + Intergenic
1013099711 6:106975680-106975702 GGAGGGGGTCCCCTCAGGGTGGG - Intergenic
1014079190 6:117268522-117268544 ATAGGGGGTCCTCTCAGCCTGGG + Intronic
1015791094 6:136965267-136965289 TGAGTGGGTACCCCCATCCTAGG - Intergenic
1017869593 6:158475626-158475648 GGAGGAGGTACCTTCAGCATGGG + Intronic
1019600599 7:1881791-1881813 TGAGGGGGCACCATGGGCCTCGG - Intronic
1019630606 7:2046939-2046961 TGAGTGGGTGCGCTCAGCCCAGG - Intronic
1020553776 7:9642932-9642954 TGAGGGGGAACACTCACCATGGG - Intergenic
1021065776 7:16170865-16170887 TGTGGGGGTCCCTTCAGCCCAGG + Intronic
1023829914 7:44033159-44033181 TGGGAGGGGACCCTGAGCCTTGG - Intergenic
1023984268 7:45085930-45085952 TGGTGGGGCACCCTCGGCCTGGG - Exonic
1025074922 7:55934595-55934617 TGAGAGGGTCACCTCAGCCCAGG - Intronic
1028634045 7:92967203-92967225 TGAGGGGGTAACTTGAGCCCAGG + Intergenic
1029740228 7:102487431-102487453 TGGGAGGGGACCCTGAGCCTTGG - Intronic
1029758224 7:102586605-102586627 TGGGAGGGGACCCTGAGCCTTGG - Intronic
1029776162 7:102685683-102685705 TGGGAGGGGACCCTGAGCCTTGG - Intergenic
1033223423 7:139543495-139543517 TGAGGGTCTACCTCCAGCCTTGG + Intronic
1034559813 7:151872670-151872692 TGAGGGGCAACCCTCAACCCAGG - Intronic
1034950916 7:155296972-155296994 TGATGTGGCATCCTCAGCCTGGG - Intergenic
1036776126 8:11614057-11614079 TGAGGCGGCAGCCTCAGGCTTGG + Intergenic
1038777325 8:30542850-30542872 TGAGGGTGGTCCCTAAGCCTTGG + Intronic
1043944910 8:86238732-86238754 TGAGAGGGTAGCCTGAGCCCTGG - Intronic
1045030329 8:98128828-98128850 TGGGAGGGTACCCTGAGCCAGGG + Intronic
1047354596 8:124108495-124108517 TGAGGCGTTTCCCTCATCCTGGG - Intronic
1049163113 8:141110332-141110354 TGAGGGGATTCCTTCAGCCGTGG + Intergenic
1049923866 9:390211-390233 TGAGGGAGTGGACTCAGCCTGGG - Intronic
1050801265 9:9617717-9617739 TGAGGGTGTCCTCTAAGCCTTGG + Intronic
1051726039 9:20089019-20089041 TGGGTGGGTCCCCCCAGCCTGGG + Intergenic
1052951527 9:34217153-34217175 TGAGAGGATGCCATCAGCCTTGG + Intronic
1055613150 9:78043832-78043854 TGGGAGGGTAGCCTGAGCCTGGG - Intergenic
1057855744 9:98599588-98599610 AGAGGTGGCCCCCTCAGCCTGGG - Intronic
1058428809 9:104900035-104900057 TGAGGGGGGACCATCAGCCAGGG - Intronic
1058742525 9:107958178-107958200 TGAGAGGGTCACCTGAGCCTGGG - Intergenic
1059995361 9:119903569-119903591 TGAGGGGCTACGCTGAACCTGGG + Intergenic
1060729972 9:126031014-126031036 TGAGGGGGCTACCGCAGCCTGGG - Intergenic
1062205109 9:135332026-135332048 TGATGGGGTAAACTTAGCCTGGG - Intergenic
1062734054 9:138125493-138125515 TGAGGGGGTCCCACAAGCCTGGG + Intergenic
1188928165 X:36070992-36071014 TGAGCTGCTACCCTCTGCCTAGG + Intronic
1190096761 X:47487601-47487623 TGAGGGGATCACCTGAGCCTGGG - Intergenic
1191849764 X:65577516-65577538 TGAAGCTGAACCCTCAGCCTGGG - Intergenic
1192035397 X:67557564-67557586 GGAGAGGGTACCTACAGCCTAGG - Intronic
1200008943 X:153107299-153107321 TCAGGGGTTGCCCTCTGCCTTGG - Intergenic
1200030657 X:153292623-153292645 TCAGGGGTTGCCCTCTGCCTTGG + Intergenic
1200069232 X:153519599-153519621 TGAGGGGCTGACCTCACCCTGGG - Intronic
1200209354 X:154339834-154339856 TGAGAGGATCCCTTCAGCCTGGG + Intergenic
1200221522 X:154392293-154392315 TGAGAGGATCCCTTCAGCCTGGG - Intronic