ID: 1070830560

View in Genome Browser
Species Human (GRCh38)
Location 10:79415606-79415628
Sequence GTGAGGGGGTACCCTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830560_1070830574 24 Left 1070830560 10:79415606-79415628 CCAGGCTGAGGGTACCCCCTCAC 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data
1070830560_1070830575 27 Left 1070830560 10:79415606-79415628 CCAGGCTGAGGGTACCCCCTCAC 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830560_1070830569 9 Left 1070830560 10:79415606-79415628 CCAGGCTGAGGGTACCCCCTCAC 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1070830569 10:79415638-79415660 CACCCTCTCCCAGGTCTGAAAGG No data
1070830560_1070830565 0 Left 1070830560 10:79415606-79415628 CCAGGCTGAGGGTACCCCCTCAC 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1070830565 10:79415629-79415651 TCCTCCCTGCACCCTCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830560 Original CRISPR GTGAGGGGGTACCCTCAGCC TGG (reversed) Intronic
901009284 1:6190112-6190134 GTCAGGAGATACCCTCACCCTGG + Intronic
901554420 1:10020195-10020217 GTGAGGGGATAGCTTAAGCCAGG + Intergenic
902476502 1:16691338-16691360 GATAGGGGGCACCCTCAACCTGG + Intergenic
902789897 1:18760601-18760623 GTGAGAGGATAACCTGAGCCAGG - Intergenic
902796942 1:18806242-18806264 GTGAGGAGGGACCCTTAACCTGG + Intergenic
906461193 1:46035941-46035963 GTGAGGGGGCAGCCTCGGCATGG - Exonic
907457727 1:54586120-54586142 GGGTGGGTGTTCCCTCAGCCAGG + Intronic
914249339 1:145908679-145908701 GTGAGGGGGTAGCCTGAGAGGGG - Intronic
916990846 1:170243172-170243194 CTGAGGTGGGAACCTCAGCCAGG - Intergenic
918051659 1:180978477-180978499 GTGTGGGGGTCCCCTTCGCCTGG - Intronic
919899316 1:202032333-202032355 CGGAGGGGTTAGCCTCAGCCAGG - Intergenic
920433360 1:205932922-205932944 GTGAAGGGGCTCCTTCAGCCAGG - Intronic
920789099 1:209071673-209071695 GTAAGGGGGTACCCACACGCAGG - Intergenic
920792415 1:209105950-209105972 GGAAGGGGGTGGCCTCAGCCTGG - Intergenic
922620320 1:226984666-226984688 GGGTGGGGGCACCCGCAGCCAGG + Intronic
922725757 1:227922299-227922321 GTCAGGGGCTGCCCTCAGCAGGG + Intronic
923642527 1:235779160-235779182 GAGAAGTGGTACCCTCGGCCAGG - Intronic
924797113 1:247300471-247300493 GTGAGGGGGCAGCACCAGCCAGG + Exonic
1062979489 10:1710238-1710260 ATGAGGGGGAAACCACAGCCAGG - Intronic
1066265114 10:33769381-33769403 GTGAGAGGGTTCCTTGAGCCTGG - Intergenic
1067224742 10:44368336-44368358 GTGATGGGGTCCCCTCAGCACGG - Intergenic
1069240281 10:66129942-66129964 GTGGTGGGGTACCCTCATGCAGG - Intronic
1070138326 10:73715553-73715575 GTGGGGGGGGCCCCTCTGCCCGG - Intergenic
1070830560 10:79415606-79415628 GTGAGGGGGTACCCTCAGCCTGG - Intronic
1071456600 10:85856000-85856022 GTGAGGGGGCACCCCCAACCTGG - Intronic
1071555352 10:86597367-86597389 GTCAGGAGGAACACTCAGCCAGG - Intergenic
1073102838 10:101015840-101015862 GAGAGGGGCTTCCCTCAGCAGGG + Intronic
1073251446 10:102122170-102122192 GGGAGGGGGTGCACTCAGGCAGG - Intergenic
1073352594 10:102830701-102830723 TTTAGGTGCTACCCTCAGCCTGG + Exonic
1076577538 10:131479783-131479805 GTGAGAGGGTCACCTGAGCCTGG - Intergenic
1076782961 10:132734635-132734657 GGCAGGCGGTACCCTCATCCTGG - Intronic
1077269055 11:1666533-1666555 TGGTGGGGGTACCGTCAGCCCGG - Intergenic
1077271493 11:1684182-1684204 TGGTGGGGGTACCGTCAGCCCGG + Intergenic
1077315924 11:1919336-1919358 GTGTGGGGGTCCCCAGAGCCAGG - Intergenic
1077439113 11:2560038-2560060 GGGAGGGGGTACCGCCAGCCTGG + Intronic
1080023767 11:27592535-27592557 GTGATGGGCTGCCATCAGCCAGG + Intergenic
1081854418 11:46294958-46294980 GTGGGGGGGAATCCTGAGCCCGG - Intronic
1083671791 11:64304058-64304080 GAGAGGGGCTGCACTCAGCCTGG - Intronic
1083749574 11:64753824-64753846 GTGAGGGGGGACACCCAGTCTGG - Intronic
1084156079 11:67313276-67313298 GTGAGAGGGTCTCTTCAGCCTGG - Intergenic
1089111303 11:116059784-116059806 GTGAGTGAGTACCATGAGCCAGG + Intergenic
1089817911 11:121192992-121193014 GTGAGTGGGTTGCCTGAGCCCGG - Intergenic
1090841124 11:130488027-130488049 GTCACTGGGTGCCCTCAGCCAGG + Intergenic
1091906768 12:4195421-4195443 GTGAGAGGGACCCCTCAGACTGG - Intergenic
1092229746 12:6769885-6769907 GAGAGGGAGTAGCCTCAGGCTGG - Intronic
1101431536 12:104631539-104631561 TTCATGGGGGACCCTCAGCCTGG + Intronic
1101901257 12:108792656-108792678 GGGAGGGGGGGCCCTAAGCCGGG + Exonic
1103614411 12:122143077-122143099 ACGAGGAGGTACCCTCGGCCGGG - Exonic
1103976432 12:124705684-124705706 GTGAGGGGGTAGCATGAGCCAGG - Intergenic
1104753488 12:131254580-131254602 GTGGGGGAGGACCCCCAGCCAGG - Intergenic
1108863279 13:54889668-54889690 GTGAGAGGGTCACCTCAGACTGG - Intergenic
1112565036 13:100545428-100545450 GTGAGGGGGTGCCCTCCTCCAGG - Intronic
1117063897 14:51989701-51989723 GTGAGGCGGCGGCCTCAGCCCGG + Intronic
1117700669 14:58410163-58410185 GTGAGAGGGTCACCTGAGCCCGG - Intronic
1117797155 14:59406200-59406222 GTGGGGAGGTAGCCTCACCCAGG - Intergenic
1118309928 14:64684595-64684617 GTGAATGTGTACCCGCAGCCTGG - Intergenic
1121193950 14:92053588-92053610 GTGAGAGGATACCTTGAGCCTGG - Exonic
1121976431 14:98408368-98408390 ATGAGGGGGCACCATCACCCTGG + Intergenic
1122152276 14:99731610-99731632 GTGGGGGGGACCCCTCTGCCTGG - Intergenic
1122470500 14:101962879-101962901 GTGAGGGGAAACCCTCTGCATGG + Intergenic
1125861587 15:43005241-43005263 GTGGGGGGGCAGCCTCTGCCCGG + Intronic
1127883497 15:63178659-63178681 GTGAGAGGATACCTTGAGCCTGG + Intergenic
1129263891 15:74383723-74383745 GTGTGGTGGAACCATCAGCCTGG - Intergenic
1132880286 16:2159117-2159139 GGGAGGGGGTCCCCACAGCTCGG - Intronic
1133253660 16:4502507-4502529 GTGTGTGTGTGCCCTCAGCCTGG + Intronic
1133838285 16:9385842-9385864 GGGGTGGGGGACCCTCAGCCTGG + Intergenic
1136485808 16:30571188-30571210 CCGAGGGGGTGCCCTCAGCCTGG - Intronic
1137912523 16:52392444-52392466 GACACAGGGTACCCTCAGCCAGG + Intergenic
1138543257 16:57701292-57701314 GAGAGGCTGTACCCTGAGCCTGG - Intronic
1144749540 17:17638898-17638920 GTGAGAGGATTCCCTGAGCCTGG + Intergenic
1146176150 17:30667703-30667725 GTGTGGGGGTCCCATCGGCCGGG + Intergenic
1146551310 17:33782633-33782655 GTGAGAGGGTTGCCTGAGCCTGG + Intronic
1146723570 17:35140107-35140129 GTGCAGGGGCACCCTCTGCCAGG + Intronic
1146942992 17:36856827-36856849 TTTTGGGGGGACCCTCAGCCAGG + Intergenic
1147599144 17:41734935-41734957 GGGAGGGGCTGCCCCCAGCCAGG - Intergenic
1148209318 17:45798750-45798772 GGGCGGGGGCACCCTGAGCCGGG + Intronic
1148879962 17:50718211-50718233 GCGAGGGGGTCGCCTGAGCCCGG + Intergenic
1151576006 17:74952983-74953005 GTGAGGAGGGACCCTGTGCCAGG - Intronic
1152458470 17:80429371-80429393 GTGGGGGTGTCCTCTCAGCCTGG - Intronic
1152465406 17:80463596-80463618 GTGAGAGGATACCTTGAGCCAGG - Intergenic
1152537991 17:80961365-80961387 GGGAGGGGGCACGCTCAGCGTGG - Intronic
1152641959 17:81452942-81452964 GTGAAGGGGCACCAGCAGCCTGG - Intronic
1153220222 18:2854451-2854473 ATTAGGGAGTAACCTCAGCCAGG + Intronic
1153227688 18:2910544-2910566 GTGGGGAGGTCCCCACAGCCCGG + Intronic
1153991638 18:10405853-10405875 GGGAGGGGGTTCCATCATCCAGG + Intergenic
1154070557 18:11148783-11148805 GTGAGGGGCTACCCAGAGCCCGG - Intergenic
1155005760 18:21727668-21727690 GTGAGGGGATAGCTTAAGCCAGG + Intronic
1157396408 18:47345475-47345497 GTGGGCAGGTTCCCTCAGCCTGG + Intergenic
1157550732 18:48580270-48580292 GTGAGTGGGTCCCCTCAGGAGGG + Intronic
1158015286 18:52775869-52775891 GTGAGGGTGGAGCCCCAGCCAGG + Intronic
1161056488 19:2193191-2193213 GTGAGGGGTCCCCCGCAGCCAGG - Intronic
1162829678 19:13276504-13276526 GTGAGGGGGCACCTTGTGCCGGG - Intronic
1164933684 19:32194988-32195010 GTGAGAGGGTCCCCTCTGCAAGG - Intergenic
1167837875 19:52089551-52089573 GTGAGAGGATGCCTTCAGCCCGG + Intronic
1202710521 1_KI270714v1_random:17179-17201 GATAGGGGGCACCCTCAACCTGG + Intergenic
932721147 2:74139722-74139744 ATGAGGGGGTCCCCTGAGCCTGG - Intronic
935448306 2:103180156-103180178 GGGAGGGGGCAGCCTCGGCCAGG - Intergenic
935630679 2:105210809-105210831 GTGGGGGGGTCCCCTCTGCCCGG - Intergenic
941003134 2:160221894-160221916 GTGAAGGGTGAGCCTCAGCCCGG + Intronic
946355360 2:219181206-219181228 GTAAGGGGCTGCCCTAAGCCAGG + Intronic
947649699 2:231775401-231775423 GTGAGGGGATCACCTGAGCCTGG - Intronic
948541926 2:238697394-238697416 GTGAGGGGGAACCCAAAGGCAGG - Intergenic
1170010543 20:11717780-11717802 GTGAGGCTGTGACCTCAGCCTGG - Intergenic
1172938240 20:38636354-38636376 GTGAGAGGGTCACCTGAGCCTGG - Intronic
1174715292 20:52751073-52751095 TTGAGGCTGAACCCTCAGCCAGG + Intergenic
1176548666 21:8212458-8212480 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
1176556560 21:8256666-8256688 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
1176567597 21:8395493-8395515 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
1176575499 21:8439708-8439730 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
1178302540 21:31465102-31465124 GTGAGAGGATTCCCTCAACCTGG + Intronic
1178737721 21:35167741-35167763 GTCAGAGGATGCCCTCAGCCAGG + Intronic
1179765806 21:43572139-43572161 GAGAGGGGATACCATCAGCCAGG + Intronic
1180257668 21:46643829-46643851 TGGAGTGGGGACCCTCAGCCAGG + Intronic
1181023107 22:20113650-20113672 GGGAGAGGGTGCCCTCAGCAGGG + Intronic
1181621593 22:24095160-24095182 GTGAGGGGGGCCACTTAGCCAGG + Intronic
1184045800 22:41971610-41971632 GTGAGGGGGGACCCTCCTCCAGG - Intergenic
1203253549 22_KI270733v1_random:128763-128785 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
1203261604 22_KI270733v1_random:173841-173863 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
954710958 3:52504877-52504899 GTGAGGGAGGAGCCTCAGCCTGG + Intronic
955467064 3:59248432-59248454 AGGAGAGGGTACCCTCAGACAGG + Intergenic
960647408 3:119902806-119902828 GTGGGAGGGTAGCTTCAGCCCGG - Intronic
961244689 3:125440985-125441007 GTGAGAGGGTACCCTGAGAGTGG - Intergenic
961831868 3:129627106-129627128 CTGGGGGTGTACCCGCAGCCGGG - Intergenic
962291144 3:134137326-134137348 GGGAGAGGGAACCCTCAGCAGGG + Intronic
962600184 3:136985630-136985652 AAGAGTGGGGACCCTCAGCCAGG - Intronic
966914554 3:184577621-184577643 GAGAGGGGGCACCCTCAGGTGGG - Intronic
967058467 3:185850629-185850651 GTGAGGTGGTAATCTCAGGCTGG - Intergenic
968932470 4:3588522-3588544 GAGAGGGGGCAGCTTCAGCCAGG - Intronic
972518715 4:39833480-39833502 GTGAGGGGATCACCTGAGCCTGG - Intronic
974228007 4:59073189-59073211 ATGAGGGTTTACCCTCTGCCTGG - Intergenic
975369364 4:73567449-73567471 ATTAGGGGATACCCTAAGCCCGG + Intergenic
975732778 4:77354008-77354030 GTGAGGTTGGAGCCTCAGCCAGG + Intronic
975734368 4:77367104-77367126 GTGAGGTTGGAGCCTCAGCCAGG + Intronic
977441148 4:97070040-97070062 TTGAGGGGGTAGCCTTTGCCAGG - Intergenic
981005251 4:139867841-139867863 GTGGGGCGGTGGCCTCAGCCAGG - Intronic
985512177 5:319028-319050 GTGTGGGGGTACCCGGAGCTGGG + Intronic
997533782 5:134599887-134599909 GTGGGAGGATACCTTCAGCCAGG + Intergenic
998135447 5:139671840-139671862 GTGCTGTGGAACCCTCAGCCAGG + Intronic
1002259668 5:177984584-177984606 GTGAGGGGGTAAAGTCGGCCCGG + Intergenic
1006386333 6:33733124-33733146 GTCAGGGGGTGCCCTGACCCAGG + Intronic
1007633506 6:43285253-43285275 GGGAGGGGGTGCCATCAGGCTGG - Exonic
1012153022 6:95779496-95779518 GTGAGAGGATGCCTTCAGCCTGG + Intergenic
1015223419 6:130830260-130830282 GTGAAGGGGCACCCCCAGCCAGG + Intronic
1017869592 6:158475625-158475647 GGGAGGAGGTACCTTCAGCATGG + Intronic
1018220251 6:161571023-161571045 GCAAGAGGGTACCTTCAGCCAGG - Intronic
1024217057 7:47256630-47256652 GTTAGGGGGCACCCTCACCTAGG - Intergenic
1035041586 7:155932018-155932040 GTGGAGGGGTCCCCTCAGGCAGG - Intergenic
1045030328 8:98128827-98128849 ATGGGAGGGTACCCTGAGCCAGG + Intronic
1045484905 8:102623244-102623266 GGGAGGGGGCAGTCTCAGCCTGG - Intergenic
1047346555 8:124034334-124034356 GTAAGGGAGTACCCTTATCCTGG + Intronic
1047452010 8:124973351-124973373 GAGAGGGGGTACCTTCCTCCCGG + Exonic
1048857535 8:138697338-138697360 GTGAGGGGGTAGAATCAGGCCGG + Intronic
1049299558 8:141862385-141862407 GGGAAGCGGTGCCCTCAGCCGGG - Intergenic
1052637678 9:31124395-31124417 GAGAAGGGGTAGCCTCAACCAGG + Intergenic
1054457656 9:65443374-65443396 GAGAGGGGGCAGCTTCAGCCAGG + Intergenic
1055613151 9:78043833-78043855 GTGGGAGGGTAGCCTGAGCCTGG - Intergenic
1058428810 9:104900036-104900058 CTGAGGGGGGACCATCAGCCAGG - Intronic
1058742526 9:107958179-107958201 GTGAGAGGGTCACCTGAGCCTGG - Intergenic
1062734053 9:138125492-138125514 GTGAGGGGGTCCCACAAGCCTGG + Intergenic
1203469950 Un_GL000220v1:111910-111932 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
1203477771 Un_GL000220v1:155882-155904 GAGAGGGGGTTGCCTCAGGCCGG - Intergenic
1190096762 X:47487602-47487624 GTGAGGGGATCACCTGAGCCTGG - Intergenic
1195694261 X:107655215-107655237 GGGAGGGGGTGTCCTCAGCCAGG - Intergenic
1198115480 X:133540798-133540820 GTCAGGCTGTACCCTCTGCCTGG - Intronic
1199471431 X:148199841-148199863 GTCTGGGGGTACCATCAGACAGG + Intergenic
1200209353 X:154339833-154339855 GTGAGAGGATCCCTTCAGCCTGG + Intergenic
1200221523 X:154392294-154392316 GTGAGAGGATCCCTTCAGCCTGG - Intronic