ID: 1070830561

View in Genome Browser
Species Human (GRCh38)
Location 10:79415620-79415642
Sequence GGGTGCAGGGAGGAGTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2198
Summary {0: 1, 1: 0, 2: 24, 3: 260, 4: 1913}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830561_1070830574 10 Left 1070830561 10:79415620-79415642 CCCCCTCACTCCTCCCTGCACCC 0: 1
1: 0
2: 24
3: 260
4: 1913
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data
1070830561_1070830575 13 Left 1070830561 10:79415620-79415642 CCCCCTCACTCCTCCCTGCACCC 0: 1
1: 0
2: 24
3: 260
4: 1913
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830561_1070830569 -5 Left 1070830561 10:79415620-79415642 CCCCCTCACTCCTCCCTGCACCC 0: 1
1: 0
2: 24
3: 260
4: 1913
Right 1070830569 10:79415638-79415660 CACCCTCTCCCAGGTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830561 Original CRISPR GGGTGCAGGGAGGAGTGAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr