ID: 1070830562

View in Genome Browser
Species Human (GRCh38)
Location 10:79415621-79415643
Sequence AGGGTGCAGGGAGGAGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1509
Summary {0: 1, 1: 0, 2: 17, 3: 163, 4: 1328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830562_1070830569 -6 Left 1070830562 10:79415621-79415643 CCCCTCACTCCTCCCTGCACCCT 0: 1
1: 0
2: 17
3: 163
4: 1328
Right 1070830569 10:79415638-79415660 CACCCTCTCCCAGGTCTGAAAGG No data
1070830562_1070830575 12 Left 1070830562 10:79415621-79415643 CCCCTCACTCCTCCCTGCACCCT 0: 1
1: 0
2: 17
3: 163
4: 1328
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830562_1070830574 9 Left 1070830562 10:79415621-79415643 CCCCTCACTCCTCCCTGCACCCT 0: 1
1: 0
2: 17
3: 163
4: 1328
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830562 Original CRISPR AGGGTGCAGGGAGGAGTGAG GGG (reversed) Intronic
900092531 1:926646-926668 AGGGAGCAGGCAGGAGAGACGGG + Intronic
900113717 1:1020016-1020038 GGGGGGCGGGGAGGAGAGAGGGG + Intergenic
900133628 1:1103562-1103584 AGGGTGCACGCAGGGGTCAGGGG + Intronic
900135685 1:1116048-1116070 AGGGCGCCGGGGTGAGTGAGGGG - Exonic
900155409 1:1201701-1201723 GGGCTGCAGGCAGGAGTGCGCGG + Intergenic
900252500 1:1678442-1678464 AGGGGGAGGGGAGGAGAGAGAGG - Intronic
900422802 1:2562914-2562936 AAGGTGGAGGGGGGAGGGAGAGG - Intronic
900427743 1:2588153-2588175 AGGGTGCAGGGAGCATGGATGGG - Intronic
900466453 1:2827866-2827888 AGGGAGGAGGGAGGTGTGAGGGG + Intergenic
900504156 1:3020939-3020961 AGTCTGCAGAGAGGAATGAGGGG + Intergenic
900509320 1:3051137-3051159 TGGGTGGAGGGATGAGTGGGTGG - Intergenic
900679269 1:3907407-3907429 AAGATGCAGGAAAGAGTGAGTGG + Intergenic
900799636 1:4729243-4729265 AGGGTGCAGGTCGGAGTGAGGGG + Intronic
900981185 1:6047252-6047274 ACACTGCAGGGAGGAGAGAGTGG - Intronic
901135074 1:6987816-6987838 AGGGGGAAGGAAGGAGTGATGGG - Intronic
901196049 1:7440306-7440328 AGGCTGCAGTGAGGATGGAGAGG - Intronic
901628546 1:10637347-10637369 AGGGAGCAGGGAGGGAGGAGTGG - Exonic
901685272 1:10940344-10940366 AGCGTGTATGGAGGAGTGGGAGG + Intergenic
901735646 1:11310548-11310570 AAGGGGCAGGGAGGTGGGAGGGG - Intergenic
901759074 1:11459079-11459101 GGGGGGCAGGCGGGAGTGAGGGG - Intergenic
901829225 1:11881890-11881912 AGGTTGCAGGGATTAGGGAGTGG - Intergenic
901869079 1:12126971-12126993 AGAGTGCAGGGACCAGGGAGGGG - Intronic
901877269 1:12173996-12174018 AGTGTGCAGGGGGGAGTGCGGGG + Intronic
902110537 1:14074574-14074596 AGGGTGCAGGGAGAGTTGGGGGG + Intergenic
902233730 1:15044423-15044445 GGGGTGTGTGGAGGAGTGAGTGG - Intronic
902389396 1:16094263-16094285 AGGGTGCAGGAAGGACTTAGAGG - Intergenic
902391063 1:16106792-16106814 AGTGTACAGGGATGAGGGAGTGG + Intergenic
902414811 1:16232357-16232379 GGGCTCCAGGGAGGAGGGAGAGG - Intronic
902580387 1:17404199-17404221 GGGATGCAGGGAGGAGGGAAGGG - Intergenic
902652804 1:17847490-17847512 AGGCAGCAAGGAGGAGGGAGCGG - Intergenic
902654933 1:17860576-17860598 AGGGTACAGGGAAGGGTGAAGGG - Intergenic
902712522 1:18250053-18250075 AGGGGGGAGGGAGGAGGGAGGGG - Intronic
903023578 1:20411401-20411423 AGAGAGCAGGGATGAGTCAGGGG - Intergenic
903238656 1:21967941-21967963 AGGCTGCAGTGAGCAGTGATGGG - Intergenic
903242581 1:21993605-21993627 AGGCTGCAGTGAGCAGTGATGGG - Intronic
903259094 1:22121609-22121631 AGGGTGCAGGGAGGAGCCCTGGG - Intronic
903355826 1:22746835-22746857 AGGGTGCAGAGGGAAGTGTGTGG - Intronic
903735482 1:25527717-25527739 AGGCTGGAGGGAGGAGGGAATGG + Intergenic
903852530 1:26316774-26316796 AGGGCCCAGGGAGGGGTGGGGGG - Intronic
904208289 1:28869188-28869210 TGGGAGCCGGGAGGAGTGACGGG + Intergenic
904266669 1:29322271-29322293 AGTGGGCAGGGAGGAGACAGAGG + Intronic
904374630 1:30072725-30072747 AGAGGGCAGAGAGCAGTGAGGGG + Intergenic
904467418 1:30716696-30716718 ATGGTGCAGGGAGGCTTGAATGG + Intronic
904486021 1:30824909-30824931 AGGGTGTATGGATGAGTGTGTGG - Intergenic
904527018 1:31141395-31141417 AGAGTGCAGGGTGAAGTGATAGG + Intergenic
904806832 1:33137951-33137973 AGGGTCCAGGGAGGTGGCAGGGG + Intergenic
904948489 1:34216625-34216647 AGGGGAGAGGAAGGAGTGAGAGG + Intronic
905254014 1:36668456-36668478 AGGGAGCAGGGAGGTGAGACAGG + Intergenic
905289639 1:36912496-36912518 AGGGAGCAGGGAAGAGAGACCGG - Intronic
905334634 1:37236051-37236073 GGGGTGCAGAGAGCAGGGAGTGG - Intergenic
905448356 1:38042191-38042213 AGGGAGCAGGGAGGAGTGTGTGG + Intergenic
905920552 1:41716097-41716119 AGGGTGCAGGGAGCACAGGGAGG + Intronic
905961421 1:42045630-42045652 GGGGTGGAGGGTGGAGAGAGGGG + Intergenic
906242709 1:44251853-44251875 AGAGGGAAGGGAGCAGTGAGAGG - Intronic
906285556 1:44585392-44585414 AAGTTGGAGGGAGGAGAGAGAGG - Intronic
906509439 1:46402468-46402490 GGGGTGGAGGCAGGAGGGAGAGG - Intronic
906529093 1:46512935-46512957 AGGCTGCAGGGAGGGGTGGCAGG - Exonic
906561080 1:46757426-46757448 ACAGTGGATGGAGGAGTGAGTGG - Intergenic
906591018 1:47024011-47024033 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
906845335 1:49185682-49185704 ATGAAGCAGGGAGGTGTGAGGGG - Intronic
906962116 1:50425164-50425186 AGGCTGGAGGGAGGAGTGGGTGG + Intergenic
907045314 1:51296912-51296934 GGTGTGCAGGGAGGACTGGGTGG - Intronic
907303725 1:53502795-53502817 AGGGACCAGAGAGGAGAGAGGGG + Intergenic
907327438 1:53648828-53648850 AGGAGGCAGGGAGGAGAGATGGG + Intronic
907410495 1:54280088-54280110 ATGGTGGTGGGAGGAGAGAGAGG - Intronic
907476996 1:54712516-54712538 ATGGAGGAGGGAGGAGGGAGAGG + Intronic
907587862 1:55637523-55637545 AGGGTGCATGCAAGAGGGAGGGG + Intergenic
907689272 1:56645673-56645695 AGGGTCCAGGGAAGAGGGCGGGG + Intronic
907736726 1:57120612-57120634 AGACTGCAGGGAGGAGGGAATGG - Intronic
907865114 1:58391741-58391763 TGGGTGCAGGAAGCAGTAAGAGG - Intronic
907877127 1:58501911-58501933 GGGGGGCAGTGAGGAGGGAGAGG - Intronic
908208696 1:61878011-61878033 AGGGTCCATGGAGGAGGCAGTGG + Intronic
908263160 1:62354249-62354271 AGGAGGCAGGAAGGAGGGAGGGG + Intergenic
909164521 1:72202270-72202292 AGGGAGTAGGGAAGACTGAGGGG - Intronic
910263005 1:85309591-85309613 AGGGTGCAAGGAGGGAGGAGAGG - Intergenic
910727302 1:90352514-90352536 CTAGTGCAGGGATGAGTGAGAGG - Intergenic
911137950 1:94462816-94462838 AAGGTGAAGTGAGGAGGGAGTGG + Intronic
912285577 1:108365100-108365122 AGGAGGAAGGGAGGAGTGGGAGG - Intergenic
912315888 1:108667455-108667477 AGCGTGCAGGGAGGTGTGGAGGG + Intergenic
912513584 1:110204379-110204401 TGGGTGGAGGGAGCAGTCAGAGG + Intergenic
912753622 1:112306116-112306138 AGGGTGCAGGGTGGGATCAGAGG + Intergenic
912878147 1:113383906-113383928 AGGCTGCAGTGAGGTGTGATCGG - Intergenic
912940496 1:114040385-114040407 AGAGTGCAGGGAGAAGTCATGGG + Intergenic
913641896 1:120820297-120820319 AGGGTGGGGGGAGGGGGGAGGGG + Intronic
914255677 1:145960256-145960278 AGGGCGCTGAGAGGAGTGAGAGG - Exonic
914334214 1:146700361-146700383 TGGCTGCAGGGAGGAGTGACAGG - Intergenic
914692433 1:150042547-150042569 AGTGTAAAGGGAGGAGTGGGAGG - Intergenic
915473648 1:156139890-156139912 GGGGTGCTGGGAGGAGGGAGAGG + Exonic
915518513 1:156428092-156428114 AGGGTGGAGGGAGGAGCCAGAGG - Intronic
915557218 1:156667460-156667482 TGGGTACAGGAAGGAGAGAGCGG + Intergenic
915898343 1:159828486-159828508 AGGGTGTAGGGAAGAATAAGAGG - Intronic
915949201 1:160176621-160176643 GGGGTGGAGGGAGCAGGGAGTGG + Intronic
915977710 1:160401340-160401362 AGGGTGTAGAGTGGAGTCAGGGG + Intronic
916029090 1:160861235-160861257 AGGGAGCAGGGAGGGAGGAGTGG - Intronic
916075362 1:161197367-161197389 AGGGAGGAGGGAGGAGGGAAGGG + Intronic
916429126 1:164710748-164710770 AGGGTTTAAGGAGGAGAGAGGGG + Intronic
916431690 1:164736150-164736172 AGGGTGAAGGGAGGGGAGAGGGG - Intronic
916588094 1:166165837-166165859 AGGGAGGAGGGAGGTGGGAGAGG + Intronic
916960241 1:169882090-169882112 AGCTTGCAGGGAGGTGTGAAGGG + Intronic
917488276 1:175475144-175475166 AGAGGGAAGGGAGGAGTCAGGGG - Intronic
917598772 1:176555191-176555213 AGGGGACAGGGAGGAGTAGGTGG + Intronic
917652200 1:177089006-177089028 AGTGTGCTGGGAAGAGAGAGAGG - Intronic
918057657 1:181036064-181036086 AGAGAGCAGGGAGGAAAGAGAGG + Intronic
918199395 1:182253233-182253255 CTGGTGCAGGGGGAAGTGAGGGG - Intergenic
918242837 1:182635225-182635247 ATGTTGCAGGGAGGCGGGAGAGG + Intergenic
918475555 1:184920523-184920545 AGGGTGAAGGGAATAGGGAGAGG - Intronic
918952787 1:191160759-191160781 AGGGTGGGGGGAGGAGGGGGAGG + Intergenic
919713735 1:200753748-200753770 GGGGAGCAGGGAAGAGTGAATGG - Intronic
920079349 1:203361011-203361033 AGGAGGCAGTGAGGAGTGGGAGG + Intergenic
920291889 1:204929246-204929268 AGAGATCTGGGAGGAGTGAGGGG - Intronic
920366286 1:205449949-205449971 GGGGTGAGTGGAGGAGTGAGTGG - Intronic
920399154 1:205666442-205666464 AGGGTGCAGCGCGCAGTGATTGG + Intronic
920441645 1:205984875-205984897 AGGAGGCAGGGAGGAGGGAGAGG - Intronic
920534593 1:206729369-206729391 AGAGGGGAGGGAAGAGTGAGTGG - Intronic
920676349 1:208041071-208041093 AGGGTGCTGGGAGGAGCCACGGG - Intronic
920908607 1:210193540-210193562 TGGGGGCAGTGAGGAGAGAGTGG - Intergenic
921054931 1:211536589-211536611 AGGGAGCAGGGAGGTGGCAGGGG - Intergenic
921936464 1:220801180-220801202 AGAGAGCAGAGGGGAGTGAGAGG - Intronic
922030821 1:221795938-221795960 AGGGAGCAAGGGGGAGAGAGGGG - Intergenic
922444365 1:225684149-225684171 AAGGTGCAGGGAGAGGTGATTGG - Intergenic
922579368 1:226685602-226685624 AGGCTGCAGGGAGGCCTGTGAGG - Intronic
922722628 1:227906468-227906490 AGGAGGGAGGGAGGAGGGAGAGG - Intergenic
922738852 1:228004749-228004771 AGGCTGCATGGAGGAACGAGCGG - Intergenic
922793016 1:228320934-228320956 TGGCTGCATGGATGAGTGAGTGG - Intronic
923237659 1:232049772-232049794 GGGGGGCAGGTGGGAGTGAGGGG + Intergenic
923239015 1:232062385-232062407 AGGGGGCAGGAAGTAGGGAGGGG + Intergenic
923293237 1:232567847-232567869 AGCCTCCAGGGAGGAGAGAGGGG + Intergenic
923459709 1:234197604-234197626 AGGGTGCTGGGGGAAGTGAGAGG + Intronic
923482624 1:234397820-234397842 AGGGGGAGGGGAGGAGGGAGGGG + Intronic
923524345 1:234760514-234760536 GGGGAGCTGGGAGGATTGAGGGG + Intergenic
923756114 1:236792685-236792707 AGGGTGAAGGTTGCAGTGAGTGG - Intergenic
923769167 1:236922315-236922337 AGGCTGCAGGGAGGAGGAAATGG + Intergenic
924369644 1:243334311-243334333 AGGTTGCAGGGAGACGTGAAAGG - Intronic
924398774 1:243654488-243654510 AGGGTGAAGGGAGTAGAGACAGG + Intronic
924556676 1:245124799-245124821 AGTGTGCAGGGTGGAGTCATGGG - Intronic
924566051 1:245199303-245199325 AGGAGGGAGGGAGGAGGGAGGGG - Intronic
924630997 1:245740715-245740737 AGGGTGGTGGGAGGAGGGAGAGG + Intergenic
924710462 1:246526826-246526848 AGGCGGCAGGAGGGAGTGAGTGG + Intergenic
924919869 1:248617360-248617382 AGGGTGTAGGGAGGAAAGTGAGG + Intergenic
1062821392 10:537034-537056 AGGGTGCAGTGAGGAGAGCCTGG - Intronic
1062937685 10:1400405-1400427 TGGTTGCTGGGAGCAGTGAGAGG - Intronic
1063217436 10:3937364-3937386 AGGGTCCAGGAAGAAGTGTGTGG - Intergenic
1063392411 10:5659179-5659201 AGGGTGCAGGGATTGGGGAGGGG - Intronic
1063517634 10:6712279-6712301 AGGGTGCTAGGAGGAGAGGGGGG + Intergenic
1063710858 10:8476423-8476445 AGGGTGGAGGGTGGAGGGAGAGG + Intergenic
1063730699 10:8694006-8694028 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1064859948 10:19816148-19816170 AGGGAGGAGGGAGGAGGGTGCGG + Intergenic
1065000969 10:21337288-21337310 TGGGGGCTGGGAGGAGGGAGAGG - Intergenic
1065184295 10:23157077-23157099 AGGAAGCAGGGAGGGATGAGGGG + Intergenic
1065207432 10:23370434-23370456 AGGGTGCAGGGGGGACGGTGGGG + Intergenic
1065741641 10:28802393-28802415 AGGATGCAGGGAGGAATCATTGG - Intergenic
1065856963 10:29838854-29838876 AGGGGGAAGGGGGGAGGGAGGGG + Intergenic
1065953926 10:30677031-30677053 AGGATGGAGGGAAGGGTGAGGGG - Intergenic
1066260477 10:33724950-33724972 AGGCAGGAGGGAGGAGGGAGAGG - Intergenic
1066299483 10:34084236-34084258 AGGGGGTTGGGAGGAGGGAGAGG + Intergenic
1066351727 10:34642421-34642443 AGGGTGTGGGGCAGAGTGAGTGG - Intronic
1066713550 10:38262482-38262504 AGGGGCCAGGAAGGAGAGAGTGG + Intergenic
1066753416 10:38683866-38683888 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1067285120 10:44902252-44902274 AGGGGGCAGGGAGGAGAGGAGGG + Intergenic
1067348199 10:45453618-45453640 TGGGTGCAGGCAGGCTTGAGAGG - Intergenic
1067357587 10:45544956-45544978 AAGGTGCTGGGAGGTCTGAGGGG - Intronic
1067452154 10:46388391-46388413 AGGGAGCAGGGACGCGTGATGGG + Exonic
1067585083 10:47471364-47471386 AGGGAGCAGGGACGCGTGATGGG - Exonic
1068131164 10:52896941-52896963 AGGGTGACAGGAGGAGTGTGGGG + Intergenic
1068732752 10:60377186-60377208 AGGGAGCAGGGAACAGTGTGGGG + Intronic
1068939208 10:62664426-62664448 AGAGTGCAGGGAGGACTGCAGGG + Intronic
1069016999 10:63441536-63441558 AGGAGGAAGGGAGGAGTGATTGG - Intronic
1069024113 10:63521585-63521607 CGGCTGCAGGGCGCAGTGAGAGG - Intronic
1069690585 10:70349050-70349072 AGGCTGCAGACAGGAGAGAGTGG + Intronic
1069748401 10:70730463-70730485 AGGCTGCAGGCAGCTGTGAGTGG + Intronic
1069890955 10:71652225-71652247 AGGGGGCAGGGAGATGAGAGAGG - Intronic
1069916321 10:71789358-71789380 GGGGTGGAGGGAGCAGTGAGGGG - Intronic
1070250343 10:74767605-74767627 AGGGAGCAGGGAAGAGCCAGAGG + Intergenic
1070651447 10:78239944-78239966 GGGGTGCAGAGAGGAGGGAGAGG - Intergenic
1070830562 10:79415621-79415643 AGGGTGCAGGGAGGAGTGAGGGG - Intronic
1071250610 10:83815239-83815261 AGGGTGAGGAGAGAAGTGAGAGG - Intergenic
1071292877 10:84200413-84200435 AGGGTGCAGGAAAGAGGGAAAGG - Intronic
1071545763 10:86528057-86528079 TGGCTACAGGGAGGAGTGAGTGG - Intergenic
1072041293 10:91609081-91609103 AGGGAGAAGGGAGGAGGTAGGGG + Intergenic
1072152779 10:92696510-92696532 AGGGCGCAGGGTGGAGGAAGGGG + Intergenic
1072305093 10:94099784-94099806 AGGGGGCAGGGAGGATCCAGTGG + Intronic
1072318558 10:94226927-94226949 AGGTTGCAGCGAGCAGCGAGAGG - Intronic
1072426902 10:95337534-95337556 GGGGTGGAGGAAGCAGTGAGAGG + Intronic
1072568032 10:96634245-96634267 AAGGTGCAGGGAGGAGAGAGGGG + Intronic
1072783535 10:98266076-98266098 AGGGAGCACGGAGGAGGGAATGG - Intronic
1072786736 10:98288401-98288423 AGGGTGGAAGGAGGAGGGTGAGG + Intergenic
1073002332 10:100294905-100294927 AGGGGCCAGGGAGGAGTGAAGGG + Intronic
1073116400 10:101094173-101094195 AGGATGCAGGGAGGCGGGGGTGG + Intronic
1073203209 10:101753085-101753107 AGTGTGCTGGGGGGAGTGAGAGG - Intergenic
1073493263 10:103869542-103869564 AGGGTGCTGGGCTGAGTGGGTGG - Intergenic
1074190205 10:111128898-111128920 AGGGGGCAGGGGGGAGGAAGGGG - Intergenic
1074217697 10:111403831-111403853 AGGGGGAAGGGGGGAGAGAGGGG - Intergenic
1074775341 10:116763968-116763990 AGGTTGCAGGGAAGTGAGAGAGG - Intergenic
1074783078 10:116816113-116816135 TGGCCGCAGAGAGGAGTGAGTGG + Intergenic
1075451721 10:122556530-122556552 AGGGGGCAAGGGGGAGAGAGAGG + Intergenic
1075781997 10:125023117-125023139 AGGATGGAGGGAGGAGCGCGTGG - Intronic
1076305546 10:129463460-129463482 ATGGTGCAGGGTGGAGAAAGGGG - Intergenic
1076370545 10:129950016-129950038 AGGGAGGAGGGAGGAGGGAGGGG + Intronic
1076401521 10:130188610-130188632 TGGGTGCAGGGTGGAGTGCTGGG + Intergenic
1076545417 10:131242267-131242289 TGGATGCTGTGAGGAGTGAGGGG + Intronic
1076776466 10:132700581-132700603 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
1076790528 10:132774804-132774826 GAGGGGCAGGGAGGAGAGAGGGG + Intronic
1076790559 10:132774891-132774913 GAGGGGCAGGGAGGAGAGAGGGG + Intronic
1076790591 10:132774982-132775004 GAGGGGCAGGGAGGAGAGAGGGG + Intronic
1076790650 10:132775125-132775147 GAGGGGCAGGGAGGAGAGAGGGG + Intronic
1076790656 10:132775142-132775164 GAGGGGCAGGGAGGAGAGAGGGG + Intronic
1076845034 10:133065755-133065777 AGGATGGATGGATGAGTGAGTGG + Intergenic
1077142030 11:1028985-1029007 AGGGTGCAGGCACCAGGGAGCGG + Intronic
1077151677 11:1075625-1075647 AGGGAGCAGCGGGGAATGAGGGG - Intergenic
1077160434 11:1110112-1110134 TGGGGGGAGGGCGGAGTGAGGGG - Intergenic
1077172044 11:1171153-1171175 TGGGTGAATGGATGAGTGAGTGG - Intronic
1077235601 11:1480678-1480700 GAGGAGCAGGGAGGAGGGAGGGG + Intronic
1077301601 11:1849807-1849829 AGGGTGTAGGGAGGAGAGGCTGG + Intergenic
1077323270 11:1951995-1952017 AGGGGGCAGGGAGGAGGGCTGGG - Intronic
1077357403 11:2124892-2124914 TGGGTGGATGGAGGAGTGAGTGG + Intergenic
1078022990 11:7670984-7671006 AAGGTGCAGGGAGGAGGAGGAGG + Intronic
1078101032 11:8330431-8330453 AGGGTGGAGGCAGGAGGCAGGGG - Intergenic
1078145809 11:8721267-8721289 AGGTTGTAGGGAGGAGTGGGAGG - Intronic
1078425222 11:11244292-11244314 AGTGTGCAGGGCTGAGTGGGCGG - Intergenic
1078856376 11:15208921-15208943 AGTGTGTGGGGCGGAGTGAGTGG + Intronic
1078856662 11:15210826-15210848 GGGGTGGAGGGAGGATTGAAAGG + Intronic
1078864891 11:15288384-15288406 AGAGTACACGGAGGAGTAAGTGG + Intergenic
1079267777 11:18951410-18951432 AGTGTGTAGGTAGAAGTGAGTGG - Intergenic
1080452151 11:32386541-32386563 AGGATGCCTGGAGGAGGGAGAGG + Intergenic
1080533358 11:33198157-33198179 GGGCTGGTGGGAGGAGTGAGCGG - Intergenic
1081547306 11:44080658-44080680 AGAGTCCAGGGAGCTGTGAGAGG + Intronic
1081884998 11:46487192-46487214 AGGGTGCAGTGAGTCGTGACTGG + Intronic
1081970055 11:47192057-47192079 AGGCTGCAGTGAGCAGTGATTGG + Intergenic
1081999143 11:47383421-47383443 AGGGAGCAGGGAGGAAGGGGAGG + Intergenic
1082063886 11:47883073-47883095 AGGAGGCAGAAAGGAGTGAGGGG + Intergenic
1083039080 11:59668912-59668934 AGGGAGCGGGGAGGGGAGAGGGG + Exonic
1083263385 11:61535254-61535276 AGGGGACAGGGAGGAGCGTGCGG + Intronic
1083418766 11:62542025-62542047 AGTGTGCAGGGAGGAGGGGCAGG + Intronic
1083610775 11:64003155-64003177 GGGCTGCAGGGAGGAGGCAGAGG - Intronic
1083617612 11:64034486-64034508 AGGGTGAAGTGAGGAGGGAGAGG + Intronic
1083687357 11:64384606-64384628 AGGGAGCAGGCAGGAGGGAGGGG - Intergenic
1083691169 11:64409769-64409791 GGGGTGCCGGGAGGAGGGAGAGG - Intergenic
1083713135 11:64560824-64560846 AGGGTGGTGGCAGGAGGGAGTGG - Intronic
1083731176 11:64653537-64653559 GGGGTGCAGGCAGGAGGGTGAGG - Intronic
1084037869 11:66523906-66523928 CGAGGGCAAGGAGGAGTGAGTGG - Intronic
1084070805 11:66733026-66733048 AGGGTGCAGGGAAAACAGAGGGG + Intergenic
1084106462 11:66983999-66984021 ATGGGGCAGGGAGCAGGGAGAGG - Intergenic
1084329593 11:68422849-68422871 AGGGTGCAGGGGCGGGTGAGTGG - Intronic
1084429301 11:69102363-69102385 ACAGGGCAGGGAGGACTGAGAGG + Intergenic
1084671592 11:70610038-70610060 AGGGACCAGGGAGGGGTGAGGGG + Intronic
1084834938 11:71795544-71795566 AGCGTGCTGGCAGGGGTGAGGGG - Intronic
1084893282 11:72247680-72247702 AGAGTGCAGAGTGGAGTTAGGGG - Intergenic
1084933253 11:72573572-72573594 AGGGGGCAGGGAGAAAAGAGTGG - Intergenic
1084944793 11:72632773-72632795 GGGGTGGTGGGAGGTGTGAGGGG - Intronic
1085266175 11:75239447-75239469 AGGGGGTAGGGAAGAGAGAGGGG + Intergenic
1085283687 11:75346540-75346562 AGCGGGCAGAGAGGAGTGGGAGG - Intronic
1085716364 11:78877245-78877267 AGGAAGAAGGGAGCAGTGAGAGG - Intronic
1085808108 11:79655198-79655220 TGGGGAAAGGGAGGAGTGAGTGG - Intergenic
1085893877 11:80613393-80613415 AGGGTGCAGTGAGCAGAGATTGG + Intergenic
1086824601 11:91480558-91480580 AGGGTGAAGGGTGGAGGGTGAGG + Intergenic
1086947135 11:92854234-92854256 TGGGTGCTGGGAGCAGGGAGAGG + Intronic
1087442970 11:98208609-98208631 TGGGTGCTGGGAGCAGGGAGAGG + Intergenic
1088462349 11:110093956-110093978 AGGGACGAGGGGGGAGTGAGGGG - Intronic
1088746305 11:112807765-112807787 ATGGGGGAGGGAGGAGTCAGAGG - Intergenic
1088807354 11:113364741-113364763 GGGGTGCAGGGAGATGTCAGCGG - Intronic
1089035863 11:115390376-115390398 GGGGGGCAGGGAGGAGAGGGAGG + Intronic
1089151074 11:116364847-116364869 TGGGTGGAGGGAGCAGAGAGTGG + Intergenic
1089329092 11:117677468-117677490 AGGGAGCAGGGGGCAGGGAGAGG + Intronic
1089398155 11:118149269-118149291 AGGATGCGGGGAGGAAAGAGGGG + Intronic
1089418801 11:118315688-118315710 AGAAGGCAGGGAGGAGGGAGCGG - Exonic
1089496437 11:118910598-118910620 GGGGTGCAGGGCGGGGGGAGGGG - Exonic
1089544806 11:119215598-119215620 AGGGTGGAGGTTGCAGTGAGCGG + Intronic
1089556683 11:119319126-119319148 AGGGAGCAGGGTGGAGGGAGCGG + Intronic
1089640338 11:119843694-119843716 AGAGTCCAGGCAGGGGTGAGGGG + Intergenic
1089643987 11:119865883-119865905 GGTGTGCAGGGAGGACTGAAGGG - Intergenic
1089729179 11:120510165-120510187 ACGGGGCTGGGAGGAGGGAGAGG - Intergenic
1089787953 11:120921596-120921618 AGGGTGGAGGCAGGAGCGGGAGG - Intronic
1090189020 11:124756411-124756433 AGGGTGCAGGGCAGAGGGAGAGG - Intronic
1090204686 11:124877790-124877812 AGGGTGGAGGTAGGTCTGAGAGG - Intronic
1090238231 11:125164946-125164968 AGGCAGCAGGGAGGAGAGAGAGG + Intronic
1090249238 11:125239841-125239863 AGTGTGCAGAGAGCAGTGACAGG + Intronic
1090402854 11:126460116-126460138 AGGGGGAAGGGGGGAGGGAGCGG + Intronic
1090636224 11:128692210-128692232 ACGCTGAAGGGAGGAGTGAGAGG + Intronic
1090804798 11:130196282-130196304 CAGGTTCAGGGAGGAGGGAGGGG + Intronic
1090874888 11:130780046-130780068 AGGCGGCAAGGAGCAGTGAGGGG - Intergenic
1091122055 11:133064992-133065014 AGGGGCCAGGGTGGGGTGAGTGG + Intronic
1091207783 11:133833084-133833106 AGGGTGCGGGGGTGAGGGAGGGG + Intergenic
1091273620 11:134334649-134334671 GGGGAGCAGGGAGGAGTAGGAGG - Intronic
1202806258 11_KI270721v1_random:7190-7212 AGGGGGCAGGGAGGAGGGCTGGG - Intergenic
1091449519 12:563586-563608 AGGGTGGAGGGTGGTGTGGGAGG - Intergenic
1091697159 12:2635524-2635546 AGGGTGCATGGAGGAGCTGGGGG - Intronic
1091764953 12:3113745-3113767 AGGCTGCAGGGCAGAGTGAAGGG - Intronic
1091768989 12:3139361-3139383 AGGGTGAGGGGAGGAGGGGGAGG - Intronic
1091799099 12:3313573-3313595 AGGGTGTCAGGAGGGGTGAGGGG + Intergenic
1092150029 12:6241600-6241622 AGCGGGCAGGGAGGGGTGCGTGG + Intergenic
1092211778 12:6651089-6651111 GGGGTTCAGGGAGGAGTGGATGG - Exonic
1092349443 12:7743996-7744018 AGGGTGCAAGAGAGAGTGAGGGG + Intronic
1092572468 12:9739959-9739981 AGCTTGCAGGGAGGTGTGGGAGG - Intergenic
1092636723 12:10459065-10459087 AGAGTGGTGGGAGGAGGGAGAGG - Intergenic
1092960367 12:13591222-13591244 AGGGTGGAAGGAGGGCTGAGTGG + Intronic
1093189356 12:16057361-16057383 AGCTTGCAGGGAGGAGTGGAGGG + Intergenic
1093633562 12:21438004-21438026 TAGGCGCAGGGAGGAGTGGGAGG + Intronic
1093695841 12:22159354-22159376 GGGTTACAGGGAGGAGAGAGAGG - Intronic
1093700165 12:22211324-22211346 AGTCTCCAGGGAGGAGAGAGGGG - Intronic
1094555698 12:31497816-31497838 AGGGGGCAGGGAGGGGCAAGGGG + Intronic
1094555731 12:31497878-31497900 AGGGGGCAGGGAGGGGCAAGGGG + Intronic
1094838485 12:34333234-34333256 AGGTGGCAGGGAGGATTGAAAGG + Intergenic
1094841579 12:34344662-34344684 AGGTTGCAGGGAGGCTTGAATGG - Intergenic
1094846972 12:34365584-34365606 AGGGAGCAGGAAGGCGTGATAGG - Intergenic
1095828166 12:46552454-46552476 GGGCTGGAGGCAGGAGTGAGGGG - Intergenic
1095953055 12:47791819-47791841 TGGGTGGAGGGAGGAGTCATGGG - Intronic
1095953293 12:47793332-47793354 AGGGTGGCGGGTGGAGGGAGGGG - Intronic
1096077725 12:48815502-48815524 AGGGAGGAGGGAGGAGAAAGAGG + Intronic
1096243114 12:49969921-49969943 AGGGTCCAGTGAGAGGTGAGTGG + Intronic
1096255857 12:50062061-50062083 AGAGCAGAGGGAGGAGTGAGAGG - Intronic
1096259493 12:50081900-50081922 AGGCAGCATGGAGGAGAGAGGGG - Exonic
1096303754 12:50456065-50456087 GGGGAGCGGGGAGGGGTGAGAGG - Intronic
1096388075 12:51208239-51208261 AGGTTGCAGTGAGCAGTGAGTGG + Intronic
1096810183 12:54164345-54164367 TGGCTGCAGGGAGTACTGAGGGG + Intergenic
1096876620 12:54634709-54634731 GGGGTGAAGGCAGGAGTGAGGGG + Intronic
1096980643 12:55726692-55726714 AGGATGCAGGCAGATGTGAGTGG - Exonic
1097041361 12:56158032-56158054 AGGGTGCTAGGAGGAGAGGGCGG + Intronic
1097135224 12:56847490-56847512 TGGGTGGTGGGAGGAGGGAGAGG - Intergenic
1097246213 12:57609210-57609232 AGGGGGCAGAGAGGAGAAAGAGG - Exonic
1097285512 12:57874051-57874073 AGGGAGGAGGGAGAAGGGAGTGG + Intergenic
1097535889 12:60870205-60870227 AGGGTGAAGGGTGGAAGGAGAGG - Intergenic
1098776516 12:74627023-74627045 AGGGTGGAGGGAGGAGGGTAAGG - Intergenic
1099282655 12:80671879-80671901 AGAGTACAGTGAGGAGTGTGGGG - Intronic
1100068423 12:90680276-90680298 TGGGCACAGAGAGGAGTGAGGGG - Intergenic
1100229541 12:92593218-92593240 AGGGCGCAGGTAAGGGTGAGAGG - Intergenic
1101576701 12:106003989-106004011 AGGCTGCAGTGAGGAGTTTGAGG + Intergenic
1102060357 12:109926662-109926684 AGGGTGCTGGGAGCTGAGAGAGG - Intronic
1102101320 12:110281126-110281148 AGGGAGCCGGGAGGAGGGGGCGG + Intronic
1102394258 12:112574227-112574249 AGGGGGCATGGAGGAGGGGGAGG + Intronic
1102512969 12:113428197-113428219 AGGAGGGAGGGAAGAGTGAGGGG + Intronic
1102531108 12:113547248-113547270 AGTGGGAAGGGAGGAGGGAGCGG + Intergenic
1102598771 12:114012988-114013010 AGGGAGGAGGGAGGAGAGGGAGG + Intergenic
1102598782 12:114013017-114013039 AGGGAGGAGGGAGGAGGGAGAGG + Intergenic
1102640234 12:114360649-114360671 TGGGTGGATGGATGAGTGAGTGG + Intronic
1102789875 12:115635986-115636008 AGGGGGAGGGGAGGAGGGAGGGG + Intergenic
1102999569 12:117375098-117375120 GGTGAGCAGGGAGGAGGGAGAGG + Intronic
1103004374 12:117409428-117409450 TGGGTGTATGGAGGGGTGAGTGG + Intronic
1103107030 12:118237432-118237454 AGGTTGCAGGGAGGAGAGTGTGG + Intronic
1103219469 12:119231865-119231887 AGGGAGGAGGAAGGAGGGAGAGG - Intergenic
1103238916 12:119397806-119397828 AGGGGGGAGGGAGGGGGGAGGGG + Intronic
1103425469 12:120830311-120830333 AGGGGGAAGGGAGGGGTGGGGGG + Intronic
1103698347 12:122835057-122835079 TGGGTGGAAGGAGGAGGGAGGGG + Intronic
1103932878 12:124459881-124459903 AGTGTGCAGGGGACAGTGAGGGG - Intronic
1104048907 12:125183653-125183675 AGAGTCTAGGTAGGAGTGAGAGG + Intergenic
1104463263 12:128971615-128971637 GGGGGGAAGGGAGGAGGGAGGGG - Intronic
1104463273 12:128971634-128971656 GGGGGGAAGGGAGGAGGGAGGGG - Intronic
1104463283 12:128971653-128971675 GGGGGGAAGGGAGGAGGGAGGGG - Intronic
1104463293 12:128971672-128971694 GGGGGGAAGGGAGGAGGGAGGGG - Intronic
1104463303 12:128971691-128971713 GGGGGGAAGGGAGGAGGGAGGGG - Intronic
1104463313 12:128971710-128971732 GGGGGGAAGGGAGGAGGGAGGGG - Intronic
1104463332 12:128971748-128971770 GGGGGGAAGGGAGGAGGGAGGGG - Intronic
1104463374 12:128971858-128971880 AGGAGGGAGGGAGGAGGGAGGGG - Intronic
1104601950 12:130160909-130160931 AGGGAGCAGGGTGGAGTGTGCGG - Intergenic
1104749195 12:131227790-131227812 AGCTTGCAGGGAGGTGTGGGGGG + Intergenic
1104759687 12:131289474-131289496 GCTGTGCAGGGAGGAGGGAGAGG - Intergenic
1104849217 12:131863287-131863309 AGGGTGAAGTGGGGAGGGAGGGG + Intergenic
1104950456 12:132437568-132437590 AGGGAGGAGGGAGGGGAGAGAGG + Intergenic
1105070780 12:133233171-133233193 AGGAGGCTGGGAGGAGTCAGAGG + Intronic
1105349426 13:19602193-19602215 AGTGTGCGGGGCGGAGGGAGCGG + Intergenic
1105425602 13:20292395-20292417 AGCTTGCAGGGAGGTGTGAAGGG + Intergenic
1105439192 13:20401805-20401827 AGTGTGCAATGAGGAGTGATCGG - Intergenic
1105442879 13:20430002-20430024 AGGGAGCATGGAGGAGTTCGGGG - Intronic
1105587280 13:21756864-21756886 AGAGTGCAGGGTGAAGTCAGGGG - Intergenic
1106232682 13:27833400-27833422 AGGGTGAAAGGAAGAGGGAGAGG - Intergenic
1106454110 13:29911798-29911820 AGGGTGGAGGTAGGAATGAGTGG + Intergenic
1106477101 13:30108340-30108362 AGGGCGCAGTGAGGAGGGAGGGG - Intergenic
1106486745 13:30179327-30179349 AGGGTGCAGTGAGGGGTGAGAGG - Intergenic
1106486746 13:30179334-30179356 AGGGTGAAGGGTGCAGTGAGGGG - Intergenic
1107124373 13:36830572-36830594 GGGGTGCAGGAAGTAGTAAGGGG + Intergenic
1107137953 13:36964966-36964988 AAGGTGGGGTGAGGAGTGAGTGG + Intronic
1107648742 13:42522847-42522869 AAAGTGAAGGAAGGAGTGAGAGG - Intergenic
1107767708 13:43755461-43755483 AGAGAGCATGCAGGAGTGAGAGG - Intronic
1107875889 13:44790094-44790116 TGGGTGCGGGGAGCAGAGAGAGG + Intergenic
1107999450 13:45892780-45892802 AGGGAGGAGGGAGGAGGCAGAGG + Intergenic
1108002281 13:45915306-45915328 TGGGTACAGGGAGCAGGGAGAGG - Intergenic
1108122261 13:47202111-47202133 AGGGTGGAGGCTGCAGTGAGTGG - Intergenic
1108477508 13:50835544-50835566 ACGCTGCAGGGAGGAGGGATGGG - Intronic
1108535481 13:51372192-51372214 GGGGTTATGGGAGGAGTGAGAGG - Intronic
1108594260 13:51936440-51936462 AGGGGGCAGGGAGCAGGGGGCGG + Intronic
1108760763 13:53560987-53561009 AAGTTGCAGGGAGAAGTGGGAGG - Intergenic
1109259662 13:60129218-60129240 TGGGAGGAGGGGGGAGTGAGGGG - Intronic
1109431130 13:62237139-62237161 AGGGTGGAGGTTGCAGTGAGTGG - Intergenic
1110014804 13:70386975-70386997 TGGGTGCTGGGAGCAGGGAGAGG + Intergenic
1110201066 13:72851330-72851352 TGGGTGCTGGGAGTAGGGAGAGG - Intronic
1110251458 13:73385136-73385158 AAGGAGCAGGCAGGAGTGGGAGG + Intergenic
1110439198 13:75508265-75508287 TGGGTGCCGGGAGCAGGGAGAGG + Intergenic
1111366942 13:87259798-87259820 AGGGGGCAGGGAGGGGAGGGAGG + Intergenic
1111464820 13:88594948-88594970 TGGGTGCTGGGAGCAGGGAGAGG + Intergenic
1111787637 13:92810593-92810615 GGGGTGGAGGGAGGGGTGAATGG - Intronic
1111856175 13:93640699-93640721 GGGGAGGAGGGAGGACTGAGGGG - Intronic
1112089990 13:96072947-96072969 AAGGTTCAGGAAGCAGTGAGTGG - Intergenic
1112296289 13:98190048-98190070 ACGGTGCAGGGATGAGGGGGAGG - Intronic
1112441371 13:99426980-99427002 GGGGAGGAGGGAGGAGAGAGGGG + Intergenic
1112503113 13:99957215-99957237 GGGGTGGAGTGAGGAGGGAGGGG - Intergenic
1112948743 13:104963015-104963037 AAGGTGCAGGGAGTAGAGTGTGG - Intergenic
1113159566 13:107364908-107364930 AGGGGGCAGGGGAGAGGGAGAGG - Intronic
1113306881 13:109088891-109088913 AGCGGGCCTGGAGGAGTGAGGGG - Intronic
1113358579 13:109607167-109607189 AGGGTGGGAGGAGGAGGGAGAGG - Intergenic
1113367012 13:109685483-109685505 AGGGTGGAAGGAGGAGTGGGAGG + Intergenic
1113447047 13:110377365-110377387 AGTGACCAGGCAGGAGTGAGGGG - Intronic
1113576784 13:111400497-111400519 AGGGAGGAGGGAGGAGGGAAAGG - Intergenic
1113585580 13:111462055-111462077 AGGGTGGGGGGAGGAGGGGGAGG + Intergenic
1113918265 13:113887727-113887749 AGGGGTGAGGGAGGAGGGAGGGG - Intergenic
1113952987 13:114082098-114082120 TGGGTGCAGCCAGGACTGAGAGG + Intronic
1114153344 14:20071143-20071165 AGTGTGCTGGGTGCAGTGAGAGG - Intergenic
1114385438 14:22249531-22249553 TGGGGGGAGGGAGGAGTGAACGG - Intergenic
1114621852 14:24100900-24100922 AGAGTGCAGGGCTGAGGGAGAGG - Intronic
1114658395 14:24329699-24329721 AGGGTGCAGGGAGGGGAGCTGGG - Intronic
1114702832 14:24696155-24696177 AGAGTGAGTGGAGGAGTGAGTGG + Intergenic
1114702846 14:24696243-24696265 AGAGTGAGTGGAGGAGTGAGTGG + Intergenic
1114702860 14:24696331-24696353 AGAGTGAGTGGAGGAGTGAGTGG + Intergenic
1114992992 14:28312650-28312672 GGGGTGGGGGGAGGAGGGAGGGG - Intergenic
1115724175 14:36194709-36194731 AGGGGGAAGGGAGGGGAGAGGGG + Intergenic
1115874549 14:37845559-37845581 AGGATGAAGGAAGGATTGAGAGG + Intronic
1115953596 14:38750116-38750138 AGAGGGCAGAGAGGAGTGAGAGG - Intergenic
1116052322 14:39820179-39820201 AGGGGGTAGGGAGGTGGGAGAGG - Intergenic
1116317066 14:43410680-43410702 TGGGTGCTGGGAGCAGGGAGAGG + Intergenic
1116458039 14:45141519-45141541 AGGGAACAGGGAGGAGGAAGGGG - Intronic
1116972820 14:51085002-51085024 AGGTTGCAGAGAGGAGTAAATGG - Intronic
1117014863 14:51508090-51508112 CAGCTGCAGGGAGGACTGAGGGG - Intronic
1117178692 14:53170855-53170877 AGGGCTCAGGGAAGGGTGAGTGG + Intergenic
1117287169 14:54297426-54297448 AGGGTGGAGGGAGGATTAAAAGG - Intergenic
1117726858 14:58683147-58683169 ATGTTGGAGGGAGGAGAGAGTGG + Intergenic
1117733941 14:58750982-58751004 TAGGTGCAGGGAGCAGGGAGAGG - Intergenic
1118309327 14:64681105-64681127 AGGTTGCAGTGAGTAGTGAGCGG - Intergenic
1118348517 14:64957331-64957353 AGAGGGAAGGTAGGAGTGAGAGG - Intronic
1118474702 14:66105755-66105777 ATGGAGCAGGGAGAAGAGAGAGG + Intergenic
1118935031 14:70279870-70279892 TGGGGGGAGGGAGGAGGGAGAGG + Intergenic
1119218565 14:72888158-72888180 TGGAAGCAGGGAGGGGTGAGAGG - Intronic
1119527291 14:75332941-75332963 ATGGAGCAGGAAGGAGAGAGAGG + Intergenic
1119662273 14:76460524-76460546 AGGGAGCAGGGAGGAGCTGGAGG - Intronic
1119717452 14:76868905-76868927 AGGGGGCTGCAAGGAGTGAGTGG + Intronic
1119758071 14:77132728-77132750 AGGGGAAAGGGAGAAGTGAGAGG - Exonic
1119768980 14:77208501-77208523 AGGCTGAAGGGAGGAGAGGGAGG - Intronic
1119778240 14:77261190-77261212 AGTGTGCAGGGAGGGGTGAGTGG + Intergenic
1119889693 14:78173594-78173616 AGGGTGGGGGGAGCAGTGTGTGG - Intergenic
1119960448 14:78849718-78849740 AGGGTGCAGGGTGGAAAGAAAGG + Intronic
1120769890 14:88367551-88367573 TGGAGGCAGGGAGGAGGGAGAGG - Intergenic
1121241133 14:92430803-92430825 AAGGTGGAGGGAGGAGGGAAGGG - Intronic
1121273590 14:92653093-92653115 AGGTGGCAGGGAGGAGAGGGCGG + Intronic
1121369799 14:93346897-93346919 AGGTTGCAGGGAGCCCTGAGTGG + Intronic
1121417250 14:93788182-93788204 AGGGTGCAGGCAGGAGTCGGTGG - Intronic
1121453302 14:94023007-94023029 TGGGGCAAGGGAGGAGTGAGGGG + Intergenic
1121653559 14:95577557-95577579 AGGGAGCAGGCAGGTGTCAGGGG + Intergenic
1121792005 14:96705651-96705673 CGTTTGCAGGGAGGACTGAGTGG + Intergenic
1121857958 14:97288010-97288032 TGGGTGGATGGAGGAGTGGGTGG + Intergenic
1122199662 14:100114740-100114762 GAGGAGCAGGGAGGAGAGAGAGG - Intronic
1122263546 14:100536371-100536393 AGGGTGTGGGGAGGGGTGACAGG + Intergenic
1122322045 14:100861122-100861144 AGGGTGCTGGCAGGTGTGTGGGG - Intergenic
1122448169 14:101782966-101782988 AGGGGGAAGGGAGGGGGGAGAGG - Intronic
1122486823 14:102087359-102087381 GGGGTGCAGGGCGGAGGGCGCGG - Intronic
1122804754 14:104250660-104250682 AGGAGGGAGGGAGGAGGGAGAGG + Intergenic
1122915110 14:104854974-104854996 AGGTTGAAGGGAGGGGGGAGTGG + Intergenic
1122915119 14:104854997-104855019 AGGGTGAATGGAGGGGGGAGTGG + Intergenic
1122915241 14:104855351-104855373 AGGGTGAAGGGAGGGGAGAGTGG + Intergenic
1122915292 14:104855516-104855538 AGGGTGAATGGAGGGGGGAGTGG + Intergenic
1122958325 14:105083117-105083139 GGGGTGGAGAGAGGAGTGAATGG - Intergenic
1122958510 14:105083782-105083804 TGGGTGGAGGGAGGATGGAGGGG - Intergenic
1124094173 15:26633379-26633401 AAGGTACAGGGAAGAGAGAGTGG - Intronic
1124100353 15:26687089-26687111 AGGGTGCAGGGAGGAGTCTCTGG + Intronic
1124122073 15:26895991-26896013 AGGGTGCAGGGAAGGGTGGAAGG - Intronic
1124137640 15:27048860-27048882 AGGGGGCAGGAAGGAAGGAGAGG - Intronic
1124377444 15:29137080-29137102 AGGGTGGAGGCGGGAGTGGGGGG + Exonic
1124404648 15:29382611-29382633 AGGGAGGAGGCAGGAGAGAGGGG - Intronic
1124957752 15:34370851-34370873 AGGGGGAAAGGAGGAGGGAGGGG - Intergenic
1124995855 15:34722342-34722364 AGGCTGGAGGGTGGAGTGAGAGG - Intergenic
1125279693 15:38030683-38030705 AGATTGCAGGTAGGTGTGAGTGG - Intergenic
1125316161 15:38433856-38433878 AGGGAGGAGGGAGGAGGGAGGGG - Intergenic
1125447760 15:39776179-39776201 GGGGCGGAGGGAGGAGAGAGAGG + Intronic
1125720447 15:41842652-41842674 AGGAGGCCTGGAGGAGTGAGGGG + Intronic
1125876988 15:43157662-43157684 ATGGTGCAGGGAGGGGAGATAGG - Intronic
1125953946 15:43776677-43776699 AAGGTGCAGGGGAGAGGGAGCGG - Intronic
1127221252 15:56883948-56883970 AGGGTGCAGGGAGATGGGAAAGG - Intronic
1127400085 15:58576767-58576789 AGGTTGCAGGGAGCTGTGATAGG - Intergenic
1127426787 15:58865639-58865661 TGCGTGCCGGGAGGAGTGAAGGG - Intronic
1127538453 15:59913432-59913454 TGGGTCCAGGGAGGAGTGTACGG - Intergenic
1127657692 15:61071430-61071452 AGGGAGAGGGGAGGAGAGAGGGG + Intronic
1127657707 15:61071474-61071496 AGGGAGAGGGGAGGAGAGAGGGG + Intronic
1127924049 15:63520996-63521018 AGGGGGTGGGTAGGAGTGAGCGG - Intronic
1127961129 15:63891794-63891816 AAGGGGCAAGGAGGAGGGAGAGG - Intergenic
1128133102 15:65243826-65243848 AGGACTTAGGGAGGAGTGAGGGG - Intronic
1128227331 15:66011224-66011246 AGGGAGCAGTGAGGAGGGAGGGG + Intronic
1128229618 15:66025390-66025412 AGGGAGGAGGGAGGAGGGAGAGG + Intronic
1128465411 15:67906782-67906804 AGGAGGCAGAAAGGAGTGAGGGG + Intergenic
1128491004 15:68144390-68144412 ATGGGGCAGAGAGGAGGGAGTGG - Intronic
1128616401 15:69113996-69114018 AGTGTGCAGGGTGGATTGTGGGG - Intergenic
1128637769 15:69314077-69314099 AGGGAGCAGGGAGTTCTGAGAGG + Intronic
1128658914 15:69483561-69483583 AGAGGGCAGGGAGGAGTCAGAGG + Intergenic
1128731353 15:70023683-70023705 GAGGTGGAGGGAGCAGTGAGGGG + Intergenic
1128793461 15:70449324-70449346 GGGATGGATGGAGGAGTGAGTGG + Intergenic
1129225675 15:74169042-74169064 ACGGAGGAGGGAGGAGAGAGGGG + Intergenic
1129452646 15:75659488-75659510 ATGGGGCAGGGTGGAGAGAGGGG - Exonic
1129540793 15:76346011-76346033 AGGGAGCAGGGACGAGGAAGTGG + Intergenic
1129666410 15:77581986-77582008 TGGGTGCAGCGGGGAGGGAGTGG - Intergenic
1129716734 15:77856629-77856651 AGGCGGCAGGGAGAAGGGAGAGG + Intergenic
1129944074 15:79524203-79524225 AGTGGGAAGGGAGGAGTGATGGG - Intergenic
1130141645 15:81230974-81230996 AAGCTGGAGGCAGGAGTGAGAGG + Intronic
1130298184 15:82661917-82661939 TGGGTGCTGGGAGGGGTGGGAGG + Exonic
1130371226 15:83286114-83286136 CGGGGGCACGGAGGAATGAGAGG - Intergenic
1130654031 15:85779354-85779376 AGTGAGCAGGGAGGAGGCAGTGG + Intronic
1130766856 15:86879504-86879526 AGAGGGCAAGGAGGAGTGGGAGG - Intronic
1130898355 15:88188214-88188236 AGAGTGGAGGGAGGAGAAAGAGG + Intronic
1131071647 15:89470061-89470083 AGGGTGCAGGGTGGCGTGGGGGG - Intergenic
1131098746 15:89672023-89672045 AGGGAGAAGAGAGGTGTGAGAGG + Intronic
1131256614 15:90867063-90867085 AGGGGGCAGGGAGGGGCGGGAGG - Intergenic
1131507125 15:93029012-93029034 AGGGAGGAGGGAGGAGGCAGGGG - Intergenic
1131512628 15:93057649-93057671 AGGGTGCAGGAAGGAGAGGAGGG - Intronic
1132101128 15:99024316-99024338 AGGCTTCAGAGAGCAGTGAGAGG - Intergenic
1132540115 16:504606-504628 AGGGTACAGGAAGAGGTGAGGGG - Intronic
1132540158 16:504743-504765 AGGGTGCAGGAAGAGGTGAGGGG - Intronic
1132647363 16:1005132-1005154 AGGGAGCAGGGATGGGGGAGGGG + Intergenic
1132697091 16:1206905-1206927 AGGGGGGTGGGAGGAGGGAGGGG - Intronic
1132906498 16:2285267-2285289 AGGGTGCAGGGAGGAGGCGAGGG + Intronic
1133039938 16:3055271-3055293 AGGGTGCAGGAAGGGGTGCAGGG + Intronic
1133043819 16:3075102-3075124 AGGGTGCAGGAAGGGGTGCAGGG + Intronic
1133091847 16:3410988-3411010 AGGGAGGAGGCAGGAGGGAGTGG - Intronic
1133115184 16:3574457-3574479 ACAGTGCTGGCAGGAGTGAGGGG + Intronic
1133349086 16:5089707-5089729 AGTGTGCTGGCAGGGGTGAGGGG + Intronic
1133368278 16:5228424-5228446 AGGGAGCAAGTGGGAGTGAGAGG + Intergenic
1133569517 16:7027020-7027042 AGGGAGAATGGAGGAGTGTGTGG - Intronic
1133702957 16:8326140-8326162 AGGGTGGAGGGGAGAGGGAGAGG + Intergenic
1133971927 16:10574437-10574459 ATGGAGCAGGGAGGGATGAGGGG - Intronic
1133978585 16:10617563-10617585 GGGGTGAAGGGAGGAGGGACTGG - Intergenic
1134058001 16:11182314-11182336 CTGGTGCGGGGAGGAGGGAGAGG - Intergenic
1134070242 16:11256034-11256056 AGGCGGGAGGGAGGAGGGAGGGG - Intronic
1134091194 16:11392481-11392503 AGGGGGCAGAGAGGAGAGTGTGG - Exonic
1134224785 16:12381583-12381605 TGGGTGGATGGATGAGTGAGTGG - Intronic
1134753327 16:16644502-16644524 AGGGTGGGGGGGTGAGTGAGGGG - Intergenic
1134827251 16:17294641-17294663 AGGGTGCAGGGCTGAGTTTGGGG - Intronic
1134992730 16:18714581-18714603 AGGGTGGGGGGGTGAGTGAGGGG + Intergenic
1135251545 16:20904471-20904493 AGGGGGCAGGGAGGAGAGGGTGG - Intronic
1135769133 16:25202846-25202868 AGGTTGCAAGGAGGATTAAGGGG + Intergenic
1135797553 16:25459940-25459962 AGGGAGGAGGGAGGAGAGACAGG + Intergenic
1136019713 16:27432367-27432389 AGCGTGCAGGAGGCAGTGAGAGG - Intronic
1136051072 16:27650354-27650376 AGGGTGGAGGTAGGAGTGGATGG + Intronic
1136229708 16:28879174-28879196 AAGAGGCAGGGAGGAGGGAGTGG - Intronic
1136367173 16:29814192-29814214 AGGGAGGAAGGAGGAGTGAAGGG - Intronic
1136600990 16:31288186-31288208 AGGGTGGTGGGAGGAGTGGTGGG + Intronic
1136729292 16:32393125-32393147 AGGGTGGAGGGTGGAAGGAGGGG - Intergenic
1137044167 16:35640977-35640999 TGGGTGCAGGGCTGAGTGGGAGG + Intergenic
1137442472 16:48508681-48508703 AGCTTGCAGGGAGGTGTGGGGGG + Intergenic
1137750495 16:50858009-50858031 AGCATGCAGGGAGGAGTCTGGGG + Intergenic
1137963889 16:52912159-52912181 TGGGTGGATGGATGAGTGAGAGG - Intergenic
1137988622 16:53130994-53131016 GGAGTGGAGGGAGGAGTGAAGGG - Intronic
1138004354 16:53317239-53317261 AGAGTACGTGGAGGAGTGAGTGG + Intronic
1138349886 16:56340804-56340826 AGAGTGGAGGGGTGAGTGAGGGG - Intronic
1138387949 16:56648919-56648941 AGGGTGCTGGGCAGAGTCAGAGG + Intronic
1138457638 16:57130637-57130659 AGGGCTCGGGGAGGAGGGAGTGG + Intronic
1138634538 16:58326823-58326845 AGGCTGGAGGGAGGAGGGAATGG + Intronic
1139334816 16:66224321-66224343 TGGGTGCAGTGAGGAGGGAGGGG - Intergenic
1139515794 16:67451665-67451687 TGAGTGAGGGGAGGAGTGAGTGG + Intronic
1139530205 16:67538912-67538934 AGGGTGCAGACAGCAGGGAGAGG - Intronic
1139999404 16:71010871-71010893 TGGCTGCAGGGAGGAGTGACAGG + Intronic
1140018303 16:71210508-71210530 AGGAGGGTGGGAGGAGTGAGAGG + Intronic
1140272084 16:73474933-73474955 ATGGGGCTGGGAGGAGTGGGTGG + Intergenic
1140410389 16:74737552-74737574 AGAATGCTGGGAAGAGTGAGAGG - Intronic
1140903602 16:79392296-79392318 AGAGTGAAGGAAGGAGAGAGAGG + Intergenic
1140908492 16:79430130-79430152 AGGGAGAAGGGAGCAGTGAGTGG - Intergenic
1140951583 16:79823608-79823630 AGGGTGTCAGGAGGAGGGAGAGG - Intergenic
1140997531 16:80276061-80276083 AGCGTGCAGGGAGAAGGGGGAGG - Intergenic
1141012464 16:80415721-80415743 AGGGTGCAGAGAGGAGGCATGGG - Intergenic
1141031672 16:80594555-80594577 AGGGTGCAGAGAGGAGTGCCTGG - Intergenic
1141173217 16:81704176-81704198 AGGGGGCAGGGAGGAGGCTGAGG - Intronic
1141173225 16:81704196-81704218 AGGGGGCAGGAAGGAGGGGGAGG - Intronic
1141173235 16:81704216-81704238 GGGGGGCAGGGAGGAGGGGGAGG - Intronic
1141173261 16:81704278-81704300 AGGGGGCAGGGAGGAGGGTGAGG - Intronic
1141173279 16:81704319-81704341 AGGGGGCAGGGAGGAGAGTAAGG - Intronic
1141173286 16:81704339-81704361 GGGGGGCAGGGAGGAGGGTGAGG - Intronic
1141173310 16:81704401-81704423 AGGGGGCAGGGAAGAGGGTGAGG - Intronic
1141173318 16:81704421-81704443 AGGGGGCAGGGAGGAGGGGGAGG - Intronic
1141173347 16:81704479-81704501 AGGGGGCAGGGAGGAGGGTGAGG - Intronic
1141173362 16:81704519-81704541 AGTGGGCAGGGAGGAGGGTGAGG - Intronic
1141412297 16:83843808-83843830 AGGAAGGAGGGAGGAGGGAGGGG + Intergenic
1141428917 16:83960872-83960894 TGGGTAGAGGGAGGAGGGAGAGG - Intronic
1141497168 16:84418312-84418334 AAGGGGCAAGGAGGGGTGAGGGG - Intronic
1141619545 16:85229435-85229457 AGAAGGCAGGGCGGAGTGAGAGG - Intergenic
1141648595 16:85380391-85380413 AGGGCTCAGGGAGGATTTAGAGG - Intergenic
1141946044 16:87310795-87310817 AGGAGGCAGGGAGGTGAGAGAGG + Intronic
1142018491 16:87765492-87765514 AGGGAGAAGGGAGGAGGGGGAGG + Intronic
1142114975 16:88351742-88351764 AGGGTGCAGGGGGTTGTGCGGGG + Intergenic
1142123574 16:88399220-88399242 AGGGAGCAGAGGGGAGGGAGGGG - Intergenic
1142237911 16:88931323-88931345 AGGCTGCTGGCTGGAGTGAGTGG + Intronic
1142252665 16:88999749-88999771 AGGGAGGAGGGCGGAGGGAGGGG + Intergenic
1142259377 16:89035707-89035729 AGGGTGCCGGGAGTAGAGGGTGG + Intergenic
1142261096 16:89042738-89042760 AGGGTGCAGTGATGGGTGTGGGG + Intergenic
1202997104 16_KI270728v1_random:124396-124418 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1203023791 16_KI270728v1_random:436738-436760 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1142799623 17:2337235-2337257 AGGGAGCAGGCAGAAGTCAGGGG + Exonic
1142958185 17:3535262-3535284 AGGGAGGAGGGAGGAGGGAGAGG - Intronic
1143238738 17:5425778-5425800 AGGGGACAGAGAGGAGGGAGAGG + Intronic
1143329491 17:6122660-6122682 AGTGTGGAGAGAGGAGTGACCGG + Exonic
1143381436 17:6498638-6498660 TGGGGACAGGGAGGAGTGGGTGG + Intronic
1143413415 17:6726640-6726662 GGGATTCAGGGAGGAGGGAGGGG + Intergenic
1143473915 17:7192383-7192405 AGGATAGAGGGAGGAGGGAGGGG + Intronic
1143478764 17:7217266-7217288 AGGATGGGGGGAGGGGTGAGAGG + Intronic
1144209522 17:13002783-13002805 GGTGTGCTGGGAAGAGTGAGAGG + Intronic
1144233314 17:13231109-13231131 AGGGTGCAGGAAGAAGGGAAGGG - Intergenic
1144438404 17:15261187-15261209 GGGGTGGAGGTAGGGGTGAGGGG + Intronic
1144637426 17:16919178-16919200 GGGCTGCAATGAGGAGTGAGTGG - Intergenic
1144722579 17:17482043-17482065 AGGGAGCTGGGAGGAGTGAAGGG - Intronic
1144754234 17:17669709-17669731 AGGATGGAGGGAGGAGGGAGTGG - Intergenic
1144772619 17:17768465-17768487 AGGGTGAAGGCAGGACTGAATGG + Intronic
1145269648 17:21397896-21397918 AAGGAGAAGGGAGGGGTGAGAGG - Intronic
1145735337 17:27225907-27225929 AGGGTTCAGGGAGAGGTGAGAGG - Intergenic
1145836046 17:27955057-27955079 AGGGTGGAGGGATGGGTGGGGGG + Intergenic
1145963700 17:28902476-28902498 CGGGTCCAGGGAGGAGAGCGCGG - Intronic
1145987604 17:29057640-29057662 AGGGTGGGTGGAGGGGTGAGGGG + Intergenic
1146332234 17:31937122-31937144 AGGGGGGAAGGAGGAGAGAGGGG - Exonic
1146499039 17:33348616-33348638 AGGGTGCATGGAGCAGTGAGGGG + Intronic
1146521795 17:33531301-33531323 AGGGGGCAGGGGGCAGTGGGTGG + Intronic
1146532178 17:33617499-33617521 AGGGTGGAGGGAGGGAGGAGGGG + Intronic
1146682522 17:34818340-34818362 AGGATGCAGGGGAGAGTGGGAGG - Intergenic
1146845252 17:36178352-36178374 AGGCGGCAGGAGGGAGTGAGCGG + Intronic
1146873466 17:36390195-36390217 AGGCGGCAGGAGGGAGTGAGCGG + Intronic
1146880827 17:36441283-36441305 AGGCGGCAGGAGGGAGTGAGCGG + Intergenic
1146910501 17:36645552-36645574 AGGGAGGAGGGAGGAGAGAGTGG - Intergenic
1146919651 17:36702025-36702047 ATGGAGCAGGGAGAAGCGAGTGG + Intergenic
1147065922 17:37922678-37922700 AGGCGGCAGGAGGGAGTGAGCGG - Intergenic
1147165446 17:38590865-38590887 AGGGTGTAGGAAGGACAGAGGGG - Intronic
1147187700 17:38721845-38721867 AGGGGGAAGGGAGGGGTCAGAGG - Intronic
1147189553 17:38730617-38730639 AGGGGCGAGGGAGGAATGAGAGG - Intronic
1147646247 17:42035910-42035932 AGGGGGCAGGGAGCAGCAAGTGG + Intronic
1147758164 17:42781706-42781728 TGGGGGACGGGAGGAGTGAGGGG - Intronic
1147760743 17:42796042-42796064 CGGGAGGATGGAGGAGTGAGAGG + Intronic
1148027665 17:44599830-44599852 AGGGCTCTGGAAGGAGTGAGGGG + Intergenic
1148094482 17:45042856-45042878 AGGGAGCAGGGAGGACACAGAGG - Intronic
1148194039 17:45700447-45700469 AAGGGGCAGTGAGGAGGGAGAGG - Intergenic
1148228923 17:45919196-45919218 AGGGAGCAGGCAGGGCTGAGCGG - Intronic
1148562144 17:48612232-48612254 AGGCTGCAGAGAGGAGGGGGCGG - Intronic
1148789591 17:50165980-50166002 AGGGGGCAGGGAGGAGAGGAGGG - Intronic
1148830533 17:50427951-50427973 AGGGTGCAGGCACAAGGGAGTGG - Intronic
1148896284 17:50841022-50841044 AGGGGGCAGGGAGGGGTGGGGGG - Exonic
1149104477 17:52944749-52944771 ATGGTTTAGGGAGAAGTGAGTGG + Intergenic
1149304326 17:55333804-55333826 AAGGTCCAGGGAGAAGAGAGGGG - Intergenic
1149389274 17:56173262-56173284 AGGGTGAAGGCAGGAGTGTGTGG - Intronic
1149440692 17:56671384-56671406 AGAGTGCAGGGAGGAGTGGATGG - Intergenic
1149637894 17:58185002-58185024 AGGCAGGAGGGAGGAGAGAGGGG + Intergenic
1150004700 17:61462542-61462564 AGGGTGCAGGGAGGGGAGAGGGG + Intronic
1150137219 17:62702757-62702779 AGGGTCCAGGTAGGATTGAGGGG - Intronic
1150281418 17:63931508-63931530 TGGGGGCAGGGAGGACCGAGGGG - Intronic
1150520953 17:65866188-65866210 TGGGTGCCGGGAGCAGGGAGAGG - Intronic
1150523934 17:65901824-65901846 AGGCTGAAGGGAGGGGTAAGGGG + Intronic
1150645698 17:66976357-66976379 AGGATGGAGGGAGAAGGGAGGGG - Intronic
1151013821 17:70531230-70531252 AGGGTGGAGGGTGGTGGGAGTGG + Intergenic
1151366900 17:73623459-73623481 GGGGGGAAGGAAGGAGTGAGGGG + Intronic
1151471683 17:74322300-74322322 AGGCTGCAGGCAGCAGTGATGGG + Intergenic
1151527989 17:74684160-74684182 AGGTTGCAGTGAGGAGGCAGAGG - Intronic
1151713788 17:75821251-75821273 ATGGTGCAGGAAGGAGTGTGTGG - Intronic
1151745865 17:76011448-76011470 GGGCTGCAGGCAGGAGGGAGAGG + Intronic
1151878627 17:76881428-76881450 AGGGTCCAGGGAAGAGGGATGGG + Intronic
1152103353 17:78315360-78315382 AGGGTTCAAGGAGGAGTTAGTGG + Intergenic
1152133235 17:78489828-78489850 AGGGTGAATGGATGGGTGAGTGG + Intronic
1152197894 17:78928320-78928342 ATGGTGTGGCGAGGAGTGAGAGG + Intergenic
1152221806 17:79072858-79072880 AGCCTGCAGGGAGGTGTCAGAGG + Intergenic
1152258092 17:79251958-79251980 AGGCTGCTGGGTAGAGTGAGAGG - Intronic
1152303482 17:79508497-79508519 GGGGTGCGGGGAGCAGAGAGAGG - Intronic
1152362390 17:79838876-79838898 GGGGTGGAGGGAGGAGGGGGTGG - Intronic
1152551984 17:81034732-81034754 AAGGTGCGGGGAGGAGAGCGGGG - Intergenic
1152771779 17:82174217-82174239 AGGGAGCACGGAGGAGCCAGCGG - Intronic
1152809859 17:82376287-82376309 AGGAGGCAGTGAGGGGTGAGTGG - Intergenic
1152859089 17:82685227-82685249 AGGGAGGACGGAGGAGGGAGGGG + Intronic
1152874940 17:82781225-82781247 TGGGTCCAGGGAGGAGGGAGGGG + Intronic
1152928935 17:83100299-83100321 AGGGCCCAGGGAAGGGTGAGGGG + Intergenic
1153003851 18:480299-480321 AGTGTTCATGGATGAGTGAGAGG - Intronic
1153428868 18:4993363-4993385 TGGGTGCTGGGAGCAGGGAGAGG + Intergenic
1153499661 18:5735434-5735456 TAGGTGAAGGGAGGAGTGAATGG - Intergenic
1153762450 18:8344919-8344941 AGGGAGGAGGGAGAAGGGAGAGG + Intronic
1153778839 18:8476898-8476920 GGGGTGGAGAGAAGAGTGAGAGG - Intergenic
1153854183 18:9128934-9128956 CGGGTGAGGGGAGGAGTGGGGGG - Intronic
1153930090 18:9870613-9870635 AGGGTCCAGGAGGGAGAGAGGGG - Intergenic
1154107026 18:11532749-11532771 GGAGTGCAGGGAGGTGTGGGGGG + Intergenic
1155169790 18:23258998-23259020 TGGGGGGAGGGAGGAGGGAGAGG + Exonic
1155198257 18:23495260-23495282 AGGGAGGAGGGAGGAGAGAAGGG + Intergenic
1155557526 18:27036899-27036921 GGGCTGCAGGGAGGAGGAAGTGG + Intronic
1155999195 18:32366127-32366149 GGTGGGCAGGGTGGAGTGAGGGG - Intronic
1156173394 18:34513852-34513874 AGGGTGCAGGTAGTAGTTAATGG - Intronic
1156400170 18:36732652-36732674 AGGGGACATGAAGGAGTGAGTGG + Intronic
1156462311 18:37327878-37327900 TGGGTGCAATGAGGAGTGACAGG - Intronic
1156478830 18:37423537-37423559 AGGGACCTGGGAGGAGTGAGAGG - Intronic
1157559525 18:48636786-48636808 AGAGTGCAGAGAGGTGGGAGAGG + Intronic
1157830170 18:50850372-50850394 AAGGAGCAGAGAGGAGTGAGAGG + Intergenic
1157867402 18:51197883-51197905 CGCGTGCCGGGAGGAATGAGAGG - Intronic
1158237884 18:55339667-55339689 AGGGAGGGGGGAGGTGTGAGCGG - Intronic
1158470347 18:57730347-57730369 AGGCTGCAGGGAGGCGTGTCTGG + Intronic
1158820225 18:61150719-61150741 CAGGTGCAGAAAGGAGTGAGAGG + Intergenic
1158859444 18:61578043-61578065 AGGGTGGAGGGACAAGAGAGGGG + Intergenic
1159704955 18:71675024-71675046 AGGGCGCTGGGAGGGGAGAGAGG + Intergenic
1159844918 18:73447839-73447861 AGAGTGCAGGCAAGTGTGAGAGG + Intergenic
1160129558 18:76212781-76212803 AGGGAGCTGGGGGGAGAGAGAGG - Intergenic
1160232171 18:77056760-77056782 AGGTTGCTGGGAGGACTCAGTGG - Intronic
1160392674 18:78546957-78546979 AGGGTGGAGGGGGGAGGAAGGGG + Intergenic
1160586818 18:79917728-79917750 AGGGTGCATGGAGGCCCGAGAGG - Intronic
1160692295 19:465642-465664 TGGGTGGAGGGATGAGTGGGTGG + Intronic
1160872132 19:1282371-1282393 AGGGGGAAGGAAGGAGGGAGGGG + Intergenic
1160887551 19:1357894-1357916 AAGATGCAGGCAGGAGGGAGTGG - Intronic
1160951215 19:1668585-1668607 GGGGTGCAGGCAGCAGGGAGTGG - Intergenic
1160983255 19:1826377-1826399 TGGGAGTAGGGAGGAGGGAGGGG + Intronic
1161010087 19:1955702-1955724 AGGGTGCAGGGAGTGCTCAGCGG + Intronic
1161239357 19:3213411-3213433 AGGGGAGAGGGAGGAGGGAGAGG + Intergenic
1161243332 19:3235060-3235082 AGGGAGCGAGGAGGAGAGAGGGG - Intronic
1161251751 19:3284582-3284604 AGGGAGTAGAGAGGAGTGAAGGG + Intronic
1161270642 19:3387663-3387685 TGGGTGGAGGGAGCAGTGAGGGG + Intronic
1161301390 19:3544601-3544623 GGGGTCCAGAGAAGAGTGAGGGG + Exonic
1161366081 19:3880625-3880647 TGTGTGCAGGGAGGAGGGGGTGG - Exonic
1161415651 19:4145209-4145231 AGGAGGAAGGGAGGAGGGAGGGG + Intergenic
1161415701 19:4145356-4145378 AGGAAGCACGGAGGAGTGGGAGG + Intergenic
1161415784 19:4145613-4145635 AGGGAGCAGGGAGGAAGGGGAGG + Intergenic
1161498984 19:4602889-4602911 AGGGTGGATGGATGGGTGAGTGG + Intergenic
1161703428 19:5806622-5806644 AGGATGAAGGGAGGAGGGAGGGG - Intergenic
1161974413 19:7600383-7600405 CGGGTGCATGGATGAGTGGGCGG - Intronic
1162012089 19:7823495-7823517 AGGGGGGAGGGGGGAGGGAGGGG + Intergenic
1162126188 19:8500600-8500622 AGGGTGCAGGGAGGAGAAGGTGG - Intronic
1162367218 19:10256843-10256865 AGGGGGCGGGGAGGGGTGGGGGG + Intronic
1162727947 19:12701146-12701168 GGGGGTTAGGGAGGAGTGAGTGG - Exonic
1162915564 19:13872897-13872919 AAGGTGCCGGGAGGCGGGAGGGG + Intronic
1163164114 19:15483604-15483626 AGGGAGCTGGGAGGAGTAAGGGG - Intronic
1163635730 19:18436497-18436519 AGGGTGTGGGGAGGATGGAGAGG + Intronic
1163675804 19:18654717-18654739 TGGGTGGAGGGAGGGGTGAATGG - Intronic
1163687269 19:18718994-18719016 AGGGAGCAGGGAGGCCTGGGAGG + Intronic
1163710712 19:18845156-18845178 AAGGGCCAGGGAGGAGTGATGGG - Intronic
1163798158 19:19349000-19349022 AGGGTGCAAGGGGCAGTCAGGGG - Intronic
1163827255 19:19530554-19530576 AGGGTGCAGGGAGGAAGTGGAGG - Intronic
1164250067 19:23468361-23468383 AGGGAGAAGGGAGGAGGAAGAGG - Intergenic
1164548072 19:29185631-29185653 GGAGTGCAGGGAGGATTCAGGGG + Intergenic
1164748439 19:30632930-30632952 AGGGTGGAGAGAGGAGGAAGAGG + Intronic
1164816898 19:31211323-31211345 AGGTTGCAGAGATGAGGGAGGGG + Intergenic
1164868722 19:31625930-31625952 TGGAGGCAGGGAGGAGGGAGAGG - Intergenic
1165257691 19:34589584-34589606 AGGCTGCAGGGAGGAGTGGAGGG + Intergenic
1165504551 19:36217124-36217146 AGGTTGCAGGGAGCAGAGATTGG - Intronic
1165522975 19:36329054-36329076 AGGGGGCAGGGAGGAGGAAAAGG + Intergenic
1165735124 19:38170836-38170858 GGGGGACAGGGAGGAGGGAGCGG + Intronic
1165868517 19:38953870-38953892 AGGGTGCAGGTAGGTGGTAGAGG + Intronic
1165940019 19:39410269-39410291 AGGGAGGAGGGAGGAGTGCGGGG - Intergenic
1166258242 19:41620653-41620675 AGGGTGCAGGGAGAAATCACAGG + Intronic
1166646542 19:44536030-44536052 AGGGTGGAGGGATGGATGAGAGG + Intergenic
1166660263 19:44642601-44642623 AGGGAGAGGGGAGGAGGGAGGGG - Intergenic
1166881590 19:45933649-45933671 GAGGTGCAGGGAGGAGGGAGAGG + Intergenic
1166985383 19:46657141-46657163 GGGATCCAGGGAGGAATGAGGGG + Intronic
1166999780 19:46739037-46739059 AGGGTTCAGGGAGCACTGAGAGG + Intronic
1167038475 19:47008292-47008314 GGGGTGCAGGGAGCAGGAAGGGG - Intergenic
1167049110 19:47067883-47067905 GAGGAGCAGGGAGGGGTGAGTGG + Intronic
1167144005 19:47671530-47671552 AGGGTGCAGGAAGTAATGAAGGG + Intronic
1167608576 19:50494918-50494940 AGGGAGGAGGGATCAGTGAGAGG + Intergenic
1167622167 19:50566486-50566508 AGGGGGCAGGGAGGAGGGGAGGG + Intronic
1167622355 19:50567171-50567193 AGGGCGGAGGGAGGTGGGAGAGG + Intronic
1167955698 19:53062156-53062178 AGGCTGCAGTGAGCAGTGATTGG - Intergenic
1168030711 19:53677611-53677633 AGGGTGGAGGTTGCAGTGAGGGG - Intergenic
1168078105 19:53991574-53991596 AGGGTGGAGGGTGGAGGGTGGGG + Intergenic
1168099596 19:54134075-54134097 AGGGAGAGGGGAGGAGAGAGAGG - Intergenic
1168228629 19:55014662-55014684 AGTGTGCAGGGAGGAGGATGGGG + Exonic
1168316875 19:55488406-55488428 AGGCTGCAGGGAGGCGGCAGGGG - Intronic
1168357852 19:55713597-55713619 AGGGAGAGGGGAGGAGGGAGAGG - Intronic
925028054 2:625134-625156 AGGGAGCAGGGGGCAGTGAGGGG - Intergenic
925119344 2:1405302-1405324 TGGGTGCATGGATGAGTGAATGG - Intronic
925151036 2:1615071-1615093 AGGTTGCTGGGAGAGGTGAGGGG + Intergenic
925169791 2:1743774-1743796 AGGGGGCTGGGAGGACGGAGGGG + Intronic
925407236 2:3613532-3613554 CGGGAGCAGGGAGGGGAGAGTGG + Intronic
925494725 2:4434660-4434682 AGGGAGCTGGTAGGAGTGAAAGG - Intergenic
925767736 2:7253188-7253210 GGGGAGCAGTGAGGAGTGAATGG + Intergenic
925824214 2:7831333-7831355 AGGGCGCAGGGGGAGGTGAGAGG + Intergenic
925927184 2:8678903-8678925 AGGCTGCAGGGCGGCGTGAATGG + Exonic
925927619 2:8681745-8681767 AGGGAGGCGGGAGGAGGGAGAGG - Intronic
925937924 2:8785242-8785264 AGGGAGGAGGGTGGAGGGAGGGG + Intronic
925943331 2:8839663-8839685 AGGGTGGAGGAAGCAGTGAGAGG - Intergenic
926240474 2:11081148-11081170 AGGGGGGAGGGAGGAGGGAGGGG - Intergenic
926733035 2:16051480-16051502 AGGGTGGAGGCAGGAAGGAGTGG + Intergenic
927130222 2:20052163-20052185 AGGGTGCCTGGAGGAGTGGAGGG + Intergenic
927144630 2:20154686-20154708 AGAGTGAAGGGAGAAGTGAATGG + Intergenic
927497336 2:23559717-23559739 AGGCTGCAGGGAGGTGGGGGTGG + Intronic
928211610 2:29327965-29327987 GGGGTGCATGGAGGAGGGAGAGG + Intronic
928593216 2:32838089-32838111 ACTGTGCAGAGAGGACTGAGGGG + Intergenic
928923048 2:36545980-36546002 TGGGAGCAGGGAGGAATGGGAGG - Intronic
928980017 2:37127811-37127833 AGGGTGGAGGTTGCAGTGAGCGG - Intronic
929142150 2:38676034-38676056 AGTCTGCATGGAGGAGTCAGAGG + Exonic
929264723 2:39905181-39905203 AGGGTCCAGGCTGGCGTGAGCGG - Intergenic
929576977 2:43058049-43058071 AGAAAGCAGGGAGGATTGAGAGG - Intergenic
929774970 2:44924085-44924107 ATGGTGCAGGAAGGAGGGATTGG + Intergenic
929799087 2:45084027-45084049 ATGCTGCAGGGAGAAGGGAGAGG - Intergenic
929847228 2:45542289-45542311 CGGGTGCTGGGAGCAGGGAGAGG + Intronic
929890918 2:45918055-45918077 AGGTTGCAGGGAGGTGTGGAGGG - Intronic
930136302 2:47906342-47906364 AGTGTGAAGGGAGGAGATAGGGG + Intergenic
930223949 2:48773357-48773379 AGGGTGCAGGAAGGAGTGGCTGG + Intronic
931308714 2:61057889-61057911 AAAGTGCAGGGAGAAGAGAGGGG - Intergenic
931601903 2:64012737-64012759 AGGAGGCAGGGAGGAGGGAAAGG - Intronic
932715767 2:74100103-74100125 AGGGTGAAGAGAGGAGTCGGTGG + Intronic
932759209 2:74428585-74428607 AGGGAGCAGGGAGAAGGCAGAGG - Intronic
932822892 2:74916373-74916395 AGGGGGCAGGGAGGTGTGAGTGG + Intergenic
933772311 2:85752435-85752457 AGGGTGCTGGGAGGTGGGATGGG - Intronic
934185592 2:89671036-89671058 AGGGTGGAGGGTGGAAGGAGGGG - Intergenic
934729541 2:96647914-96647936 AGGGTGGCTGGAGGAATGAGGGG + Intergenic
934766258 2:96881735-96881757 AGGGGGCAGGGAGGGGGGAGGGG + Intronic
934844855 2:97656202-97656224 AGGGTAGAGGGAGGAGCAAGTGG + Exonic
934991214 2:98922762-98922784 AGGGGCCAGGGAGGATAGAGGGG + Intronic
935195674 2:100814268-100814290 AGGGTGCTGGGAGTTGTGGGGGG - Intergenic
935196603 2:100820078-100820100 AGGGTGGAGGGAGGAGGCAGGGG + Intergenic
935222442 2:101027190-101027212 AGGGTGGAGGGTGGGGAGAGAGG + Intronic
935266364 2:101398204-101398226 AGGGTCCAGTGAGGACTCAGTGG + Intronic
935820519 2:106887851-106887873 AGGGTGTGGGGTGGGGTGAGGGG - Intergenic
935959350 2:108409324-108409346 AGAGTGCTGGAAGGAGTGCGTGG + Intergenic
936244188 2:110812451-110812473 AGGGAGTGGGGAGGAGGGAGAGG - Intronic
936253684 2:110889493-110889515 AGGCTGCAGGGAGGGGTAATTGG - Intronic
936261176 2:110960543-110960565 AGGATGGAGGGAGGAGTTGGCGG - Intronic
936288539 2:111200219-111200241 AGGGGGCAGGGAGGGGAGTGGGG - Intergenic
936379401 2:111970732-111970754 AGGGAGGAGGGAGGAGTAGGGGG - Intronic
936385530 2:112025188-112025210 GGGCTGCAGTGAGGAGTGATCGG + Intronic
936520696 2:113210426-113210448 AGGGTCCAGGGTGGGGAGAGTGG - Intergenic
936528028 2:113255246-113255268 AGGAGGGAGGGAGGAGGGAGGGG + Intronic
936528045 2:113255281-113255303 AGGAGGGAGGGAGGAGGGAGGGG + Intronic
937053256 2:118909302-118909324 AGGGGGAAGGGAGGAGTGAGTGG + Intergenic
937104283 2:119295359-119295381 AGGATGGAGGGAGGAGGAAGGGG + Intergenic
937193884 2:120132863-120132885 TGGGGGTAGGGAGGAGTGGGGGG + Intronic
937225920 2:120368586-120368608 AGGGTGGAGGGAGGCTGGAGGGG + Intergenic
937229515 2:120389416-120389438 AGAGGCCAGGGAGGGGTGAGGGG - Intergenic
937720809 2:125093369-125093391 AGGGTGGAAGGATGGGTGAGTGG - Intergenic
938066284 2:128283663-128283685 ATGGGGGAGGGAGGAGCGAGGGG - Intronic
938184804 2:129221201-129221223 AGGGTGCAAGGAGGAGCCATGGG + Intergenic
938308118 2:130268226-130268248 AGGGAGCAATTAGGAGTGAGAGG - Intergenic
938447213 2:131388610-131388632 AGGGAGCAATTAGGAGTGAGAGG + Intergenic
938792429 2:134688794-134688816 TGGTAGCAGGGAGGAGGGAGTGG - Intronic
939008850 2:136821470-136821492 CTGGAGCAGGGAGGAGAGAGAGG - Intronic
939306684 2:140420835-140420857 GGGGTGCAGGAAGCAGTGGGAGG + Intronic
939805388 2:146769434-146769456 AGGGTGCTAGCAGCAGTGAGGGG + Intergenic
939961489 2:148569494-148569516 TGGGTGCAGGGAGGAGGCAGAGG + Intergenic
940353936 2:152718364-152718386 AGCGCGCAGGGAGAAGCGAGCGG - Exonic
940775117 2:157876456-157876478 AGGGAGCCGGGAGGGGAGAGAGG + Intergenic
941274839 2:163478283-163478305 TGGAGGCAGGGAGGAGGGAGAGG - Intergenic
941819383 2:169828606-169828628 AGGGTTGAGGGAGGAGGGAAGGG + Intronic
941951434 2:171160622-171160644 AGGGGACAGGGAGGAGGGAAAGG + Exonic
942114436 2:172713635-172713657 CGGGTGCTGGGAGCAGGGAGAGG + Intergenic
942783408 2:179672494-179672516 AGGTTTAGGGGAGGAGTGAGAGG + Intronic
942810204 2:179990590-179990612 AGGGGGCAGGGAGAGGAGAGAGG + Intronic
942868142 2:180700016-180700038 AAGGTGCAGGGAGCAGAGAGAGG + Intergenic
943321607 2:186450824-186450846 TGGCTGCAGGAAGCAGTGAGAGG + Intergenic
943467086 2:188241034-188241056 AGAGTGCAGGGTGAAGTGATGGG + Intergenic
944277194 2:197852241-197852263 AGGGAGCAGGGAGGATGGTGGGG + Intronic
944891600 2:204123048-204123070 AGGCTGGAGGGTTGAGTGAGGGG - Intergenic
945355770 2:208837560-208837582 GGGGTGGGAGGAGGAGTGAGGGG + Intronic
946368707 2:219267006-219267028 AGGGTGGAGGGAGGAACCAGAGG - Intronic
946401528 2:219471120-219471142 GGGGTCCTGGGAGGAGTCAGAGG + Intronic
946710526 2:222500374-222500396 AGGGAGCAATGAGGAGTAAGTGG + Intronic
946765348 2:223035549-223035571 AGGGGGCAGAGTGGAGTGGGTGG + Intergenic
946843202 2:223837647-223837669 AGGGCGCGGGGAGGAGGCAGCGG - Intronic
946880166 2:224169787-224169809 AAAGGGCAGGGAGGTGTGAGAGG - Intergenic
947171877 2:227320606-227320628 AGCTTGCAGGGAGGTGTGGGGGG + Intergenic
947179432 2:227399034-227399056 AGGAGGCAGGGAGGGGGGAGGGG + Intergenic
947407153 2:229790520-229790542 AGGGGGCAGGGAGCAGGGGGAGG + Intronic
947474889 2:230435705-230435727 TGGGGGCTGGGAGGAGGGAGAGG - Intronic
947752626 2:232540720-232540742 GGGGTGCAGGCAGGGGTGTGGGG + Intronic
947843624 2:233226222-233226244 GGGGTGCAGAGAGGAGAGTGGGG - Intronic
948059749 2:235034058-235034080 AGGGTCCAGGGAGAAGGGACAGG - Intronic
948080312 2:235200274-235200296 AGGGTGCTGGGAAGACTGGGGGG + Intergenic
948128778 2:235584788-235584810 ATGGGAGAGGGAGGAGTGAGCGG - Intronic
948156604 2:235788477-235788499 AGGGTGGGGAGAGGAGTGGGAGG + Intronic
948208142 2:236173523-236173545 AGAGGGCACGGAGGGGTGAGGGG + Intergenic
948270138 2:236667770-236667792 AGGTCACAGGGAGGAGTGGGTGG + Intergenic
948344141 2:237281012-237281034 AGGGGTCAGGCAGGAATGAGTGG + Intergenic
948383593 2:237567913-237567935 GGGGTGCAGGGATGAGTAGGGGG - Intergenic
948596584 2:239083291-239083313 AGGGAGCAGGTAGGAGTGCCTGG - Intronic
948685112 2:239665376-239665398 AGGATGGAAGGAGGAGTGGGTGG + Intergenic
948685140 2:239665454-239665476 AGGATGGAAGGAGGAGTGGGTGG + Intergenic
948685168 2:239665532-239665554 AGGATGGAAGGAGGAGTGGGTGG + Intergenic
948685196 2:239665610-239665632 AGGATGGAAGGAGGAGTGGGTGG + Intergenic
948685224 2:239665688-239665710 AGGATGGAAGGAGGAGTGGGTGG + Intergenic
948756191 2:240160976-240160998 AGGGGGCAGGGTGGAATGAGTGG + Intergenic
1168841941 20:915260-915282 AGGGTGCGGGGAGGTCTGAGAGG - Intronic
1168889051 20:1281960-1281982 AGGGTGGAGGGTGGAGGGTGGGG + Intronic
1169081635 20:2800733-2800755 AGAGGGCCGGGAGGAGCGAGCGG + Intergenic
1169308080 20:4510920-4510942 GGGATGCAGGGAAAAGTGAGTGG - Intergenic
1169316720 20:4597904-4597926 AGGGGGAAGAGAGGAGAGAGAGG - Intergenic
1169911864 20:10653577-10653599 AGGGTGGAGGGTGGAGGGTGGGG + Intronic
1170253763 20:14316941-14316963 AGAGGGCAGGGAGGAATAAGGGG - Intronic
1170327778 20:15176007-15176029 AGGGTACTGGGAGCAGGGAGAGG - Intronic
1170358316 20:15517212-15517234 AGGGTGACGGGTGGAGTCAGAGG - Intronic
1170358391 20:15517763-15517785 AGGGGCCAGGAAAGAGTGAGAGG - Intronic
1170594077 20:17792463-17792485 AGGGGGCAGGGAGGCCAGAGGGG - Intergenic
1170653424 20:18263931-18263953 AGGGTGCAGGGCTGTGTGAGTGG - Intergenic
1171048349 20:21832577-21832599 AGAGAGCAGGAAGGAGTCAGAGG - Intergenic
1171194738 20:23187957-23187979 AGGCTGCAGGGAGGTGTGTGGGG - Intergenic
1171389191 20:24790249-24790271 GGAGTGAGGGGAGGAGTGAGGGG + Intergenic
1171399223 20:24860896-24860918 TGGGTGGATGGATGAGTGAGTGG + Intergenic
1172008224 20:31831662-31831684 AGGGGGCAGGGAGGTGAGATTGG - Intronic
1172097677 20:32468229-32468251 AGGGTTCTGGGAGGATGGAGTGG - Intronic
1172100564 20:32482528-32482550 AAGGTGGAGGGAGGAGAGAGAGG + Intronic
1172294463 20:33798793-33798815 GGGGTTAAGTGAGGAGTGAGGGG - Intergenic
1172346957 20:34209566-34209588 TGGGTGCTGGGAGCAGGGAGAGG - Intronic
1172687790 20:36770033-36770055 AGGGAGGAGGGAAGAGAGAGGGG + Intronic
1172749132 20:37237518-37237540 AGGGTGCTGGGATCAGAGAGAGG + Intronic
1172772756 20:37391239-37391261 AGGCTGCAGGGCGGGGTCAGAGG - Intronic
1172774906 20:37401688-37401710 AGGGTGTGGGGAGGCGGGAGGGG - Intronic
1172948785 20:38708586-38708608 AGGGGGCATGAATGAGTGAGGGG - Intergenic
1173020977 20:39268159-39268181 AGGGAGAAGGGAAGAGAGAGAGG + Intergenic
1173301861 20:41810528-41810550 ACTGTGGAGGGAGGGGTGAGTGG - Intergenic
1173448715 20:43143259-43143281 AAGTTGAAGGGAGGAGGGAGAGG - Intronic
1173562487 20:44016183-44016205 AGGGTGCTGGGAGAAGGGAACGG - Intronic
1173570395 20:44071962-44071984 AGGCTGCAGGTAGGAGTTAAAGG - Intergenic
1173790932 20:45827355-45827377 GGGGAGCAGGGAGGTGGGAGGGG - Intronic
1173840137 20:46151841-46151863 ATGGAGCAGGGAGGATTGAATGG - Intergenic
1173926531 20:46785219-46785241 AGGGTGCTGGGAGGTGTGGTAGG - Intergenic
1174190455 20:48736716-48736738 AGGCTGCAGGGAAGAGGAAGAGG + Intronic
1174405573 20:50301009-50301031 TGGGTGGATGGATGAGTGAGTGG + Intergenic
1174779339 20:53374132-53374154 AGGGTGAAGGGAGGAGGGTGAGG - Intronic
1175065030 20:56277172-56277194 TGGGTGCTGGGAGCAGGGAGAGG - Intergenic
1175066169 20:56290680-56290702 AGGGTGCAGGACTGAGTCAGGGG - Intergenic
1175319966 20:58078648-58078670 GTAGTGCAGGGAGGAGTGGGGGG - Intergenic
1175403300 20:58712591-58712613 AGTGGGCAGGAAGGAGTGGGAGG - Intronic
1175415558 20:58798475-58798497 AGGGGCCCAGGAGGAGTGAGCGG + Intergenic
1175454385 20:59099977-59099999 AAGGTGGAGGAAGGAGGGAGAGG - Intergenic
1175544415 20:59768993-59769015 TGGGTGGAGGGATGAGTGAGGGG + Intronic
1175630791 20:60534760-60534782 AGAGCCCAGGGAGGAGTGTGTGG + Intergenic
1175817964 20:61893401-61893423 ATGGTGGATGGAGGGGTGAGTGG + Intronic
1175825402 20:61934026-61934048 AGGGAGCCGGGAGGAGTCAGGGG - Intronic
1175831644 20:61967797-61967819 AGGGTTCAGGGAGTGGGGAGGGG - Intronic
1175832730 20:61975666-61975688 AGGGGGCAGAGAGGAGAGCGGGG + Exonic
1175901164 20:62360418-62360440 TGGGTGGAGGGATGGGTGAGTGG + Intronic
1175931019 20:62493733-62493755 AGAGGGCAGGGAGGTGTGGGGGG + Intergenic
1175983980 20:62755179-62755201 GGGATGAAGGGAGGAGGGAGGGG - Intronic
1176044936 20:63087636-63087658 AGGGTGCAGGGACGCAGGAGCGG - Intergenic
1176048191 20:63103302-63103324 AGGGAGCGGGGAGGAAGGAGTGG + Intergenic
1176048215 20:63103361-63103383 AGGGAGCGGGGAGGAGGGAGCGG + Intergenic
1176048220 20:63103375-63103397 AGGGAGCGGGGAGGAAGGAGTGG + Intergenic
1176099333 20:63357834-63357856 CGGCTGCAGGGTGGAGAGAGGGG + Intronic
1176163506 20:63660811-63660833 GGGGTGCAGGGAGGTGGCAGTGG + Intronic
1176235154 20:64050445-64050467 AGGGTCCAGGGAGGGGCCAGTGG - Intronic
1176415163 21:6470394-6470416 ATGGTACATGGAGGAGTGATGGG - Intergenic
1176513675 21:7767394-7767416 AGGGGGCAGGGGAGAGGGAGGGG - Intronic
1177237128 21:18406378-18406400 AGTGTGCAGAGATGAATGAGAGG + Intronic
1177348125 21:19900107-19900129 AGGGTGCAGGGAGGCCGGCGGGG - Intergenic
1177869220 21:26550311-26550333 AGGGAGGAGGGAGGCCTGAGGGG - Intronic
1178016098 21:28347513-28347535 AGGGTGGAGGGAGGAAGGAAGGG - Intergenic
1178393094 21:32215258-32215280 AGGGGGAAAGGAGGGGTGAGAGG - Intergenic
1178424764 21:32470620-32470642 AGGGAGAAAGGAGGAGGGAGTGG - Intronic
1178437205 21:32570392-32570414 AGGGAACAGGGAGGCCTGAGGGG - Intergenic
1178570207 21:33728876-33728898 ATGGGGCAGGGGGGAGTGGGGGG - Intronic
1178647788 21:34397918-34397940 AGGGGGCAGGGGAGAGGGAGGGG - Intronic
1178956032 21:37022826-37022848 AGGATGGAGGGAGGAGGGAGAGG - Intergenic
1179415561 21:41195579-41195601 AGGGAGAATGGAGGTGTGAGGGG - Intronic
1179424769 21:41267026-41267048 GGGGTGGGGGGAGCAGTGAGTGG + Intronic
1179452279 21:41474816-41474838 GGGGTGAAGGGGTGAGTGAGGGG + Intronic
1179452290 21:41474848-41474870 GGGGTGAAGGGGTGAGTGAGGGG + Intronic
1179452374 21:41475064-41475086 GGGGTGAAGGGGTGAGTGAGGGG + Intronic
1179452398 21:41475156-41475178 GGGGTGAAGGGGTGAGTGAGGGG + Intronic
1179452413 21:41475219-41475241 GGGGTGAAGGCATGAGTGAGGGG + Intronic
1179452428 21:41475270-41475292 GGGGTGAAGGGATGAGTGAGGGG + Intronic
1179452479 21:41475445-41475467 GGGGTGCAGGGGTGAGTGAGGGG + Intronic
1179560151 21:42210714-42210736 GAGGTGCAGGGTGGAGGGAGGGG - Intronic
1179690663 21:43078727-43078749 ATGGTACATGGAGGAGTGATGGG - Intergenic
1179884448 21:44307557-44307579 AGCGAGCAGTGAGCAGTGAGGGG - Intronic
1179896103 21:44364596-44364618 AGGGAGTAGGGAGGAAGGAGAGG + Intronic
1179949039 21:44699432-44699454 AGGCTGCAGTCAGGAGGGAGGGG - Intronic
1180003998 21:45011575-45011597 AGGTTGGAAGGAGGGGTGAGTGG - Intergenic
1180140979 21:45893224-45893246 AGGGAGTGGGGAGGAGGGAGGGG + Intronic
1180168009 21:46040108-46040130 AGGCTGGAGGGAGGATGGAGGGG - Intergenic
1180557080 22:16586758-16586780 AGGCTGCAGTGAGCAGTGATTGG - Intergenic
1180595215 22:16968521-16968543 AGGGAGCAGGGATGTGTTAGAGG - Intronic
1180599992 22:17009329-17009351 AGGATGCAAGGAAGAGTGTGTGG + Intergenic
1181045168 22:20210900-20210922 AGGGTGCAGGCAAGGGTGTGAGG + Intergenic
1181492353 22:23268547-23268569 AGGGTACAGGTGGGAGTCAGCGG - Intronic
1181675454 22:24448467-24448489 AATGTGCAGGGAGGAGTGGGAGG + Intergenic
1181737272 22:24891987-24892009 ATGGTGGAGGCAGCAGTGAGAGG + Intronic
1181949988 22:26546871-26546893 AGGGTGAAGGGAAGAGGAAGAGG + Intronic
1181955358 22:26584295-26584317 AGCGAGTAGGGAGGAGTGGGTGG + Intronic
1182024000 22:27103039-27103061 AGGGGGCAGGGAGGATGGAGGGG + Intergenic
1182243175 22:28933779-28933801 GGGGAGGAGGGAGGAGGGAGGGG - Intronic
1182266545 22:29120188-29120210 AGGAAACAGGGAGGAGGGAGAGG + Intronic
1182266558 22:29120244-29120266 AGGAAACAGGGAGGAGGGAGAGG + Intronic
1182266598 22:29120414-29120436 AGGAAACAGGGAGGAGGGAGAGG + Intronic
1182551107 22:31101112-31101134 AGGGTCCAGGGAGGCGGGTGGGG + Intronic
1182754572 22:32668486-32668508 GGAGTGAAGGGAGGAGGGAGGGG - Intronic
1183034861 22:35133930-35133952 AGGGAGGAGGAAGGAGAGAGAGG + Intergenic
1183064183 22:35352427-35352449 AGGGGGCAGGGGGCAGGGAGTGG - Intergenic
1183101255 22:35585555-35585577 TGGGTACAGGGAGGAAGGAGTGG - Intergenic
1183276566 22:36901723-36901745 ATGGTGCAGGGATGACAGAGAGG + Intergenic
1183411924 22:37659703-37659725 AGGGTGTAGGCAGGTGTGTGGGG + Intronic
1183803194 22:40185614-40185636 TGTGTCCAGGGAGGATTGAGGGG + Intronic
1184115127 22:42417751-42417773 ATGGTGCAGGGAGAGGGGAGAGG + Intronic
1184386624 22:44180234-44180256 AGGGTGAAGGAGGGAGTGGGTGG - Intronic
1184607382 22:45581884-45581906 AGGGTGCAGGGAGGGTCGAGGGG + Intronic
1184707599 22:46225053-46225075 AGGGTGCACGGAGGAGGCTGTGG + Intronic
1184731236 22:46372236-46372258 TGGGTGGAGGGGTGAGTGAGTGG - Intronic
1184731279 22:46372397-46372419 TGGGTGGAGGGGTGAGTGAGTGG - Intronic
1184854242 22:47137774-47137796 AGGTTGGAGTGAGGAGTGTGGGG + Intronic
1184939103 22:47747916-47747938 AGGGTGAATGGAGGTTTGAGAGG + Intergenic
1185005902 22:48276927-48276949 AGGCTGCAGGGAGGGGAAAGAGG + Intergenic
1185132545 22:49047305-49047327 AGGGTGCAGAGTGGCCTGAGGGG - Intergenic
1185179392 22:49350344-49350366 AGAGCCCAGGGAGGAGGGAGAGG + Intergenic
1185197756 22:49483021-49483043 AGGCAGGAGGGAAGAGTGAGCGG + Intronic
1185212862 22:49581669-49581691 AGGATGGAGGGATGAGTGGGTGG - Intronic
1185237901 22:49725312-49725334 GGGGCCCAGGGAGGAGGGAGAGG - Intergenic
1185421279 22:50735635-50735657 AGAGAGCAGGGAGGAGTTTGAGG + Intergenic
949710888 3:6870061-6870083 AGAGAGGAGGGAGGAGAGAGTGG - Intronic
950363566 3:12467231-12467253 AGGCTGGAGGAAGGAGTGGGGGG + Intergenic
950505388 3:13391355-13391377 AGGGTGGAGGGAGGCGTGATGGG + Intronic
950528225 3:13536996-13537018 AGGTTGCAGAGAGCAGAGAGTGG + Intergenic
950693950 3:14683336-14683358 GGAGAACAGGGAGGAGTGAGAGG - Intronic
951005098 3:17606339-17606361 AGGCTGCTGGGAGGATTGGGAGG + Intronic
951264803 3:20552806-20552828 TGGGTGCTGGGAGCAGGGAGAGG + Intergenic
951267682 3:20588723-20588745 AGGTTGTGGGGAAGAGTGAGAGG + Intergenic
952258315 3:31714451-31714473 AGGCAGCGGGGTGGAGTGAGAGG + Intronic
952297492 3:32074121-32074143 GAGGTGCAGGGAGGTGGGAGAGG - Intronic
952824829 3:37515988-37516010 AGGGTGCAGGGAGAAATGAAGGG + Intronic
953061123 3:39429454-39429476 AGGAGGCTGGGAGTAGTGAGGGG - Intergenic
953389962 3:42528208-42528230 AGGGAAGAGGGAGGAGGGAGAGG - Intronic
953815989 3:46157210-46157232 AGGATGGAGGAAGGAGGGAGAGG - Intergenic
953932157 3:47010809-47010831 AGGATCCAGGTAGGACTGAGCGG + Intergenic
954133016 3:48569652-48569674 AGGGGGCAGGCAGGAATCAGAGG + Intronic
954370360 3:50166853-50166875 GTGGTGGAGGAAGGAGTGAGGGG + Intronic
954409041 3:50361831-50361853 AGAGTGTTGGGAGGAGAGAGAGG + Intronic
954411954 3:50374701-50374723 AGGGTGCAGGGCGCAGGCAGGGG + Intronic
954516585 3:51183421-51183443 GGGGTGGGGGGAAGAGTGAGAGG + Intronic
954656146 3:52195377-52195399 AAGGACAAGGGAGGAGTGAGAGG + Intergenic
954784102 3:53080698-53080720 AGGGTGTAGTAAGGAGTGAGAGG - Intronic
954924097 3:54217278-54217300 AGGCTGCAGGGAGGAGGAGGCGG - Intronic
955353780 3:58213729-58213751 AGGGTGCAGGGAGGGATGCAGGG + Intronic
955677418 3:61463211-61463233 GGGTGGCAGGGAGGAGAGAGAGG + Intergenic
956289733 3:67648816-67648838 AGGGTGCACAGAGAAGGGAGAGG - Intronic
956627102 3:71277577-71277599 AATATGCAGGGAGGAGTTAGAGG - Intronic
957053415 3:75427050-75427072 AGTGTGCTGGCAGGGGTGAGGGG + Intergenic
957378374 3:79390701-79390723 ATGGTGAAGGGAGGAGACAGAGG + Intronic
957665229 3:83217992-83218014 AGCTTGCAGGGAGGTGTGAAGGG - Intergenic
957980912 3:87509575-87509597 GGGGCGCAGAGAGGGGTGAGGGG - Intergenic
958047441 3:88303159-88303181 AGGGAGAAGGGAGAAGGGAGAGG - Intergenic
958712318 3:97732268-97732290 AGGGTGCAGGGCCAAGTGCGTGG - Intronic
959802663 3:110513338-110513360 AAAGTGCATGGAGTAGTGAGAGG - Intergenic
959988257 3:112600789-112600811 AGGGAGCCAGGAGCAGTGAGGGG - Intergenic
960137658 3:114122071-114122093 AGGGCACTGAGAGGAGTGAGTGG - Intergenic
960583682 3:119301554-119301576 AGGGTGGAAGCAGGTGTGAGGGG + Intronic
960632322 3:119744510-119744532 AGGCTGGAGGGAGGACAGAGGGG + Intronic
960872158 3:122260903-122260925 GGGGTGCGGGGAGGAGAGGGAGG + Intronic
961066943 3:123884050-123884072 GGGGTGCGGCGAGGAGTCAGGGG - Intronic
961345399 3:126260511-126260533 AGAGGGAAGGGAGGAGGGAGAGG - Intergenic
961517349 3:127446156-127446178 AGGGTGGAGTCAGGAGTGGGAGG + Intergenic
961817518 3:129558880-129558902 AGGGTTCAGGGAGGAGCCAGGGG - Intronic
961887063 3:130103364-130103386 AGTGTGCTGGCAGGGGTGAGGGG + Intronic
962139225 3:132771161-132771183 GGGGTCCAAGGAGGAGGGAGGGG + Intergenic
962318777 3:134374602-134374624 CGGGGGCCGGGAGGAGGGAGCGG - Intronic
962901594 3:139766474-139766496 GTGATGCAGGGAGGATTGAGAGG - Intergenic
962991459 3:140581070-140581092 AGGGTACAGGGAGCAGGGGGAGG + Intergenic
963107417 3:141659242-141659264 AGGGCGCAGGTTGGAGTGAATGG - Intergenic
963949592 3:151184568-151184590 GGGGTGCAGCGAGTGGTGAGCGG - Intronic
964210585 3:154222653-154222675 TGGGTGCATTGAAGAGTGAGTGG + Intronic
964474075 3:157083255-157083277 AGGGCTCAGGGAGGACTGACAGG - Intergenic
965011729 3:163101642-163101664 ATTGTGCAGGGAGGTGTCAGTGG + Intergenic
965171120 3:165265690-165265712 GGGGTGAAGGGAGGGGGGAGGGG - Intergenic
965586603 3:170324595-170324617 AGGCTGCAGTGAGGAATGAATGG + Intergenic
965731294 3:171774803-171774825 AGGGTGGTGGGAGGAGGGTGGGG + Intronic
966740084 3:183224587-183224609 AGGGTGGAGAGAGAAGAGAGGGG - Intronic
967264234 3:187676068-187676090 AGGGTACAGGGAAGAGTGAGTGG - Intergenic
967984856 3:195087080-195087102 AGGCTGCGGGGAGCAGTAAGGGG + Intronic
967991010 3:195130801-195130823 AGGGTGCAGGGAGAAGGGAGAGG + Intronic
968058914 3:195713312-195713334 ACGGGTCAGGGAGGAGTTAGGGG - Intergenic
968339271 3:197941374-197941396 AGGGGGAAGGGAGGGGAGAGAGG - Intronic
968341669 3:197960582-197960604 AGGGTGTAGGGAGCTGAGAGCGG - Intronic
968521353 4:1036096-1036118 AGGGTGTGGGGTGGAGGGAGGGG - Intergenic
968582432 4:1401331-1401353 AGGGAGGAGGGAGGAGGGAGAGG + Intergenic
968603018 4:1519376-1519398 AGGGAGCAGAGGGGAGTGAGGGG - Intergenic
968652507 4:1765862-1765884 AGGGAGGAGGGAGGAGGGCGTGG + Intergenic
968657556 4:1785254-1785276 AGGCTGCTGGGAGCAGGGAGGGG + Intergenic
968711549 4:2123095-2123117 AGGCTGCAGTGAGCTGTGAGTGG + Intronic
968711906 4:2125634-2125656 AGAGAGCAGGGAGAAGTCAGAGG + Intronic
968734198 4:2286777-2286799 GGGGTGACGGGAGGGGTGAGGGG + Intronic
968799509 4:2732986-2733008 AGGATGCAGGTAGGAGAAAGAGG + Intergenic
968924685 4:3541027-3541049 AGGGGGGAGGGAGGACAGAGGGG - Intergenic
968951908 4:3699803-3699825 AGGGTGCTGGAAGCACTGAGGGG + Intergenic
968965715 4:3768159-3768181 AGGGAGTGGGGAGGAGAGAGGGG + Exonic
969243401 4:5916667-5916689 AGGGAGCAGGGAGGTGAGACAGG + Intronic
969246190 4:5934524-5934546 AGGGTGCAGGGAGGAGTGGCAGG - Intronic
969315435 4:6378853-6378875 ATGGTGCGGGGAGGACTTAGTGG - Intronic
969472047 4:7394690-7394712 AAGGTACAGGCAGGAGTGACGGG + Intronic
969570452 4:8005216-8005238 AGCGTGCAGGGAGCTGAGAGAGG - Intronic
969671574 4:8592939-8592961 AGGGTGGAGGGTGGAGGGTGGGG - Intronic
969718923 4:8882384-8882406 AGGGGGTAGGGAGGAGGGGGCGG - Intergenic
969757772 4:9161325-9161347 AGTGTGCTGGCAGGGGTGAGGGG - Intergenic
969817751 4:9698838-9698860 AGTGTGCTGGCAGGGGTGAGGGG - Intergenic
969836074 4:9842907-9842929 AGAGTGCAGGGAGGTGAAAGAGG + Intronic
969983161 4:11179722-11179744 AGGGTGCAGGCAAGAGCGACAGG - Intergenic
970079152 4:12260952-12260974 AGGGTGTTGGGAAGAGAGAGAGG - Intergenic
970462775 4:16292272-16292294 GGGGTGAACGGAGGAGGGAGAGG - Intergenic
970822374 4:20232874-20232896 GGGGAGAAGGGAGGAATGAGGGG - Intergenic
971092352 4:23360551-23360573 CAGGTGCTGGGAGCAGTGAGAGG - Intergenic
971177270 4:24292998-24293020 GGAGTGCAGGCAGGGGTGAGAGG - Intergenic
971177426 4:24293451-24293473 GGAGTGCAGGCAGGGGTGAGAGG - Intergenic
971294542 4:25377097-25377119 GCGGGGCAGGGAGGAGCGAGGGG - Intergenic
971487160 4:27171937-27171959 TGAGGGCAGGGAGGAGTGGGTGG + Intergenic
971527459 4:27639036-27639058 GGGGTGGAGGGAGGTGGGAGGGG - Intergenic
972505822 4:39718883-39718905 AGCCTGCAGGGAGGTGTGAAGGG - Intronic
973041844 4:45477731-45477753 AGCTTGCAGGGAGGTGTGAAAGG - Intergenic
974781789 4:66561862-66561884 AGCTTGCAGGGAGGTGTGGGGGG - Intergenic
975155584 4:71068623-71068645 AGGTTGCAGGTTGCAGTGAGCGG - Intergenic
975462291 4:74668477-74668499 AGGATGTAGGTAGAAGTGAGTGG + Intergenic
976066634 4:81195285-81195307 AGAATGCTGGGAGGAGGGAGAGG - Intronic
976129602 4:81870630-81870652 TGGGTGCTGGGAGCAGGGAGAGG - Intronic
976133734 4:81912445-81912467 TGGGTGTAGGGAGGTATGAGGGG - Intronic
976183461 4:82421159-82421181 GGAGTGCAGGCTGGAGTGAGTGG - Intergenic
976205451 4:82619516-82619538 AGGATGGAGGGAGGAGGGTGAGG - Intergenic
976460213 4:85302443-85302465 AGGGTGCAGGCTGTGGTGAGGGG + Intergenic
976890898 4:90046491-90046513 AGGGTCAGGGGAGGAGTGGGAGG - Intergenic
977948701 4:102944228-102944250 AGGGTGGAGGGTGGAAGGAGGGG + Intronic
978498401 4:109384289-109384311 TGGGTGCCGGGAGCAGGGAGAGG - Intergenic
978558340 4:110005107-110005129 AGGCTGCAGTGAGCAGTGAGTGG - Intronic
978617858 4:110613875-110613897 AGGGGGCAGGGAAGGGTGGGAGG + Intergenic
980085454 4:128385968-128385990 TGGGTGAGGGGAGGAGTGAGGGG + Intergenic
981005403 4:139869712-139869734 GGGATGGAGGGAAGAGTGAGGGG + Intronic
981015463 4:139969349-139969371 GGGGTGAAGTGAGGAGTGACTGG - Intronic
981029949 4:140114153-140114175 AGGGTGGAGGGAGCAGGGAAGGG - Intronic
981074630 4:140578826-140578848 AGGGCTCAGGGAGGAGGAAGAGG - Intergenic
981845450 4:149162714-149162736 AGGGGACAGGGAGGTGTGTGTGG + Intergenic
981906933 4:149932010-149932032 AGGGAGCAGGGAGGAGAGTGTGG + Intergenic
982228565 4:153187681-153187703 GGGCTGCATGGAGGAGTGACTGG + Intronic
982295947 4:153829377-153829399 AGGGAGCAGGATGGAGGGAGGGG - Intergenic
983237155 4:165192739-165192761 AGGGTACAGGCAGCAGTGGGTGG - Intronic
984070346 4:175103417-175103439 AGGGAGGAGGGAGAAGGGAGAGG + Intergenic
984070367 4:175103470-175103492 AGGGAGGAGGGAGAAGGGAGAGG + Intergenic
984070382 4:175103519-175103541 AGGGAGAAGGGAGGAGTGGGAGG + Intergenic
984110911 4:175612987-175613009 GGGGTTGAGGGAAGAGTGAGGGG - Intergenic
984499146 4:180536399-180536421 AGGTTGAAGGAAAGAGTGAGTGG - Intergenic
984761404 4:183365895-183365917 AGGCTGCAGGGAGCTGTGATTGG + Intergenic
984946467 4:184972469-184972491 AGGGTCCAAGGAGGCATGAGTGG + Intergenic
985214610 4:187637629-187637651 AGGGAGGAGGGAGGACGGAGGGG - Intergenic
985297852 4:188454817-188454839 AGGATTCAGGGAGGAGAGTGTGG + Intergenic
985635760 5:1034989-1035011 TGAGTGGATGGAGGAGTGAGTGG + Intronic
986206231 5:5627849-5627871 AGTGGGGAGGGAGGGGTGAGTGG + Intergenic
986267938 5:6206363-6206385 AGGCTGCAGTGAGCAGTGACTGG + Intergenic
986341013 5:6789137-6789159 AGGCCGCACGGAGGAGGGAGTGG + Intergenic
986413082 5:7501695-7501717 ATGTTGCAGGGGGAAGTGAGTGG + Intronic
987296308 5:16555014-16555036 AGGGAGTAGGGAGTGGTGAGGGG - Intronic
989000868 5:36758776-36758798 AGGGTGGGGGGAGGAGAGAATGG + Intergenic
989002831 5:36778662-36778684 AGGGGGCAGGGTGGTGTGTGTGG - Intergenic
989108150 5:37882630-37882652 AGGGAGCTGGGAGGAGAGATAGG + Intergenic
989237630 5:39167392-39167414 AGAGGGCAAGGAGGAGTGAGAGG - Intronic
989425492 5:41291068-41291090 CAGGTGCTGGGAGGAGGGAGAGG + Intergenic
990567355 5:57042826-57042848 AGGGAGCTGGCAGTAGTGAGTGG - Intergenic
990574630 5:57112274-57112296 AGGGTGGAGAGAGGACTGGGAGG + Intergenic
990777899 5:59324053-59324075 AGGGTGGTGGAAGGAGAGAGAGG - Intronic
991713529 5:69430984-69431006 AGGCTGCAGGGAGCTGTGAATGG - Intronic
992368635 5:76119282-76119304 AGGGTGCAGGGTGGAAAGAGGGG - Intronic
992605156 5:78448065-78448087 AGGGGGAAAGGAGGAGGGAGGGG - Intronic
992997348 5:82346536-82346558 AGGGAGGTGGGAGGAGGGAGCGG - Intronic
993042731 5:82834073-82834095 AGGGTGGAAGGAGCAGAGAGGGG + Intergenic
993139684 5:84016029-84016051 TGGGTGGTGGGAGGAGGGAGAGG - Intronic
993305627 5:86271820-86271842 AGGAGGAAGGGAGGAGTGGGAGG - Intergenic
993910637 5:93678690-93678712 AGGTTGCAGTGAGCAGAGAGCGG + Intronic
994448544 5:99909722-99909744 AGGGTGAAGAGAGGAATGGGAGG + Intergenic
994686904 5:102967126-102967148 TGGGAGCAGGGAATAGTGAGTGG + Intronic
994813419 5:104553173-104553195 AGGCTGCTGGGCGGAGTGAAAGG - Intergenic
995007248 5:107214955-107214977 GGGGTGGGGGGAGGAGGGAGGGG - Intergenic
995816311 5:116172227-116172249 AGGCTGGAGGGAGGTGTGAGAGG + Intronic
996088770 5:119330149-119330171 AGGGTACAGAGAGGACTGATGGG + Intronic
996452845 5:123646557-123646579 AGAATGAAGGGAAGAGTGAGTGG - Intergenic
996958021 5:129209050-129209072 AGGGTGGGGGGAGGGGGGAGGGG - Intergenic
997529200 5:134571781-134571803 AGGGAGCAGTGAGGAGTGTCGGG - Intronic
997713914 5:136028585-136028607 ACACTGCAGGGAGGGGTGAGGGG - Intergenic
998052127 5:139044719-139044741 ATGATGCAGGCAGGAGGGAGCGG - Intronic
998161503 5:139815189-139815211 AGGGTGGAGGGAGAAGTGGAGGG - Intronic
998352277 5:141509281-141509303 AGGGTCCAGGGTGGAGGCAGAGG + Intronic
998499115 5:142616670-142616692 TGGGTGGAGAGAGGAGTGAGTGG - Intronic
998738144 5:145166930-145166952 ATGGTGTAGTGAGGAGTGAGTGG + Intergenic
999124998 5:149240065-149240087 AGGGGGGATGGAGGAGTGTGTGG + Intronic
999182668 5:149681097-149681119 AGGGAGGAGGGAGGAGGAAGAGG - Intergenic
999188850 5:149731627-149731649 AGGGAGGTGGGAGGAGAGAGAGG + Intronic
999275176 5:150325412-150325434 AGGGGGCAGGGAGGGGTCGGAGG + Intronic
999304761 5:150512252-150512274 GGGGGGCAGGGAGCAGTGTGTGG + Intronic
1000883260 5:166721240-166721262 TGGGTGCAGGGAGGAGATGGAGG - Intergenic
1001095783 5:168774470-168774492 AGGCTGCAAGGATGAGTGATGGG - Intronic
1001489591 5:172146118-172146140 AGGGGGCAGGGAGGAGGGGGAGG - Intronic
1001741425 5:174055977-174055999 AGTGTGGAGTGAGGAGCGAGAGG + Intronic
1001763937 5:174230170-174230192 AGGGTGCAGGGAGGCTTCTGTGG - Intronic
1001854078 5:174995617-174995639 TGGGTCCAGGGAGGAGAGAGGGG + Intergenic
1002001801 5:176200199-176200221 AGGGCTGAGGGAGGGGTGAGGGG + Intergenic
1002058966 5:176615199-176615221 GGGGTGCAGCGAGGGGGGAGGGG - Intergenic
1002089579 5:176796634-176796656 AGGGTTCAGGAGGGAGTGACAGG - Intergenic
1002121322 5:177006600-177006622 AGGAGGCAGGGAGGGGTGGGCGG + Intronic
1002190746 5:177476196-177476218 GGGGTGGAGGGAGGAGGGTGGGG - Intergenic
1002345713 5:178546464-178546486 TGGGAGCAGAGAGGAGGGAGGGG - Intronic
1002421458 5:179151459-179151481 TGGGGGCAGGGAGTAGGGAGTGG - Intronic
1002538223 5:179890007-179890029 ATGCTGTAGGGAGGAGGGAGAGG + Intronic
1002639467 5:180623877-180623899 AAGGAGAAGGGAGGAGAGAGAGG - Intronic
1002695656 5:181086632-181086654 AAGCTGCAGGGAGAAGAGAGGGG + Intergenic
1002897779 6:1389485-1389507 AGGGGGCAGGGCGGGGTGGGGGG + Intergenic
1002904901 6:1440333-1440355 CTGGAGCAGGGAGGGGTGAGAGG + Intergenic
1003036155 6:2642068-2642090 AGGATGTAGGGACGAGTGAATGG - Intergenic
1003139259 6:3457112-3457134 GGGGGGCAGGGAGGAGGGGGAGG - Intergenic
1003324774 6:5083984-5084006 AGGGAGCTGGGAGCAGTGGGGGG + Intergenic
1003966219 6:11255129-11255151 AGGGTTCATGGAGAAATGAGTGG + Intronic
1004295573 6:14406862-14406884 AGGGAGCATGGAGGAAGGAGAGG + Intergenic
1004310524 6:14540994-14541016 AGGGTGCATAGAGGAGGGGGCGG + Intergenic
1004395735 6:15245394-15245416 AGGGGGCGAGGAGGAGGGAGGGG + Intergenic
1004486312 6:16069567-16069589 AGCTTGCAGGGAGGTGTGAAGGG - Intergenic
1004562240 6:16761531-16761553 CGGGCGGAGGGAGGAGGGAGGGG - Intergenic
1005892018 6:30147857-30147879 AGGTTGGAGGAAGGAGAGAGAGG - Exonic
1006187479 6:32189519-32189541 GGGGTGAAGGGAGGTTTGAGAGG + Intronic
1006297112 6:33174593-33174615 AGGAAGCAGTTAGGAGTGAGAGG + Intronic
1006440848 6:34052739-34052761 AGGGGCCCTGGAGGAGTGAGAGG + Intronic
1006459284 6:34148953-34148975 AGGGTGAAGGGAAGAGAGAGAGG + Intronic
1006910443 6:37560046-37560068 CGGGGGAAGGGAGGAATGAGGGG - Intergenic
1006985365 6:38172377-38172399 AGGGAACAGGGACAAGTGAGTGG - Exonic
1007628081 6:43257777-43257799 AGGGTGATGGGAGGACAGAGAGG - Intronic
1007703161 6:43775965-43775987 ACCTTGGAGGGAGGAGTGAGGGG + Intronic
1007866465 6:44975105-44975127 AGGGTGCAGTGAGCAGAGATCGG + Intronic
1008536798 6:52512386-52512408 AGGGTGGAGGGAGGAGAGCAGGG + Intronic
1008678455 6:53845924-53845946 AGGGTGCAGGGGTGCCTGAGGGG - Intronic
1009673506 6:66787754-66787776 AGGATGTAGGGAGGTGTCAGTGG - Intergenic
1009905635 6:69867369-69867391 TGGCTGCAGGGAGGACTGCGGGG - Intronic
1010477308 6:76303877-76303899 AGTGTGGAGGGAGGAGGGAAGGG - Intergenic
1010882763 6:81200296-81200318 ATGGTGCAGGCAAGAGAGAGTGG - Intergenic
1011187758 6:84697767-84697789 AGGGAGGAGGAAGGAGGGAGGGG + Intronic
1011309903 6:85970112-85970134 AGGGAGCAGGGAGAAGTGCGGGG + Intergenic
1011378928 6:86721359-86721381 AGGCTGCAGTGAGCAGTGATGGG + Intergenic
1011567642 6:88694831-88694853 AGGTGGAAGGGAGGAGAGAGAGG - Intronic
1011868899 6:91867742-91867764 AGGGTGGAGGAAGCGGTGAGTGG - Intergenic
1012250666 6:96976466-96976488 GGGGTGCAGACTGGAGTGAGAGG + Intronic
1012903567 6:105037489-105037511 AGGGAGCGGGGAGGAGGGGGAGG - Intronic
1013069543 6:106716139-106716161 AAGGCGCAGGGAGGAGGGTGCGG + Intergenic
1013364283 6:109424099-109424121 AGGGTGGCAGGAGGGGTGAGCGG + Intronic
1013410818 6:109881521-109881543 AGCTTGCAGGGAGGTGTGAAGGG - Intergenic
1013469323 6:110447653-110447675 AGGGAGCAGGGAAGAGGGGGTGG - Intronic
1013643084 6:112107222-112107244 AGGGTGCAGGGAGAAGCCTGAGG - Intergenic
1013833344 6:114301030-114301052 CGGGTGCAGGGATTACTGAGGGG + Intronic
1014638445 6:123878828-123878850 GTGGTGCAGGGAGGAGGGGGAGG - Intronic
1014778028 6:125533161-125533183 AGGGAGGATGGAGGAGTGTGAGG + Intergenic
1015770899 6:136767355-136767377 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
1016073807 6:139772662-139772684 AGGGAGAAGGAAGGAGGGAGGGG - Intergenic
1016076830 6:139805474-139805496 TGGGTGCTGGGAGTAGGGAGAGG + Intergenic
1016101000 6:140100343-140100365 GGGGTGGAGGTAGCAGTGAGCGG - Intergenic
1016453118 6:144203875-144203897 AGGGAGAAGGGAGGAGGGAGAGG - Intergenic
1016622522 6:146128822-146128844 AGGATGCTGGGATGAGAGAGTGG - Intronic
1017156193 6:151324546-151324568 TTGGGGCAGGGAGGAGGGAGGGG - Intronic
1017370927 6:153707560-153707582 AGGGTGAAGGGAGGAGGAAGAGG - Intergenic
1018040375 6:159916332-159916354 GGGCTGGAGGGAGGAGGGAGTGG + Exonic
1018041840 6:159931413-159931435 AGGCTGGAGGGAGGAGGAAGTGG + Intergenic
1018050781 6:160006089-160006111 AGGGTACAGGGAGGCGTGAGGGG - Intronic
1018050799 6:160006149-160006171 AGGGTACAGGGAGGCGCGAGGGG - Intronic
1018050823 6:160006224-160006246 AGGGTACAGGGAGGCGCGAAGGG - Intronic
1018095725 6:160385644-160385666 AGGCTGCAGGGAGGATTCTGGGG - Intronic
1018418007 6:163618041-163618063 AGAGTGGAGGGTGGAGGGAGAGG - Intergenic
1018430151 6:163715809-163715831 AGGCTGCAGGAATGAGCGAGGGG + Intergenic
1018600803 6:165538589-165538611 AGGGTGCATGAAGAAGTGAATGG - Intronic
1018638993 6:165889838-165889860 AGGGAGGAGTGAGGAGTGAGTGG - Intronic
1019103326 6:169649723-169649745 GGGGTGGAGGGATGAGTGAATGG - Intronic
1019142659 6:169957863-169957885 AGGGTGCAGGGAGGACCGGAGGG - Intergenic
1019157809 6:170050830-170050852 AGGGTGCAGGCAGGAGGGATGGG - Intergenic
1019321783 7:419319-419341 AGGCTGCAGGGGTGACTGAGGGG - Intergenic
1019339059 7:499732-499754 AGGCTGGAAGAAGGAGTGAGCGG - Intronic
1019374488 7:682067-682089 AGGGAGCAGGGAGGAGGGAGAGG + Intronic
1019415615 7:925433-925455 AGGGAAGAGGGAGGAGGGAGAGG - Intronic
1019420453 7:948275-948297 ATGATGGAGGGAGGGGTGAGGGG - Intronic
1019489694 7:1306446-1306468 TGGGTGGATGGATGAGTGAGTGG - Intergenic
1019489710 7:1306518-1306540 TGGGTGGATGGATGAGTGAGTGG - Intergenic
1019489727 7:1306590-1306612 TGGGTGGATGGATGAGTGAGTGG - Intergenic
1019495890 7:1340501-1340523 AGGGGGCAGGGAGCAGTCATGGG - Intergenic
1019512723 7:1426084-1426106 AGGGTGCTGAGGGGAGGGAGAGG - Intergenic
1019540855 7:1550393-1550415 AGGCTGCAGGGAGCACAGAGGGG + Exonic
1020080233 7:5282835-5282857 AGGGAGGAGAGAGGAGCGAGAGG + Intronic
1020135647 7:5586526-5586548 GTGGTTCAGGGAGGAGTGAGTGG + Intergenic
1020135653 7:5586558-5586580 CAGGCTCAGGGAGGAGTGAGTGG + Intergenic
1020283542 7:6663784-6663806 GGGGTGAAGGGAAGAGGGAGAGG + Intergenic
1020556720 7:9679594-9679616 AGGGTGGAGGGTGGAGGGAGAGG + Intergenic
1021819979 7:24487187-24487209 AGGGTGGAGGGAGGAGTCTGTGG - Intergenic
1021954184 7:25807306-25807328 AGGGAGGAGGGAGGAGTGGGGGG + Intergenic
1022383032 7:29878451-29878473 AAGGTGCAGGGAGGTGCGAGGGG + Intronic
1022780111 7:33572998-33573020 AGGAGCCAGGGAGGGGTGAGAGG - Intronic
1022796956 7:33739574-33739596 AGGGGGCAGGGGGCAGTGACAGG - Intergenic
1023058317 7:36307241-36307263 AGGGAGGAGGGAGGTGGGAGTGG - Intergenic
1023203705 7:37725351-37725373 GGGGAGCAAGGAGGAATGAGCGG + Intronic
1023542637 7:41282768-41282790 AGGGAACAGGGAGAAGTCAGCGG + Intergenic
1023761443 7:43468323-43468345 AGGGACCATGGAGGAGAGAGAGG + Intronic
1023768223 7:43531742-43531764 ATGGTGCAGGAAGGAGGCAGAGG - Intronic
1023941229 7:44769345-44769367 AGGCTGCAGGGAGGAGGAGGAGG + Exonic
1024042317 7:45565120-45565142 AGGCTGCAGGCAGGATTGGGGGG - Intergenic
1024328994 7:48137987-48138009 AGGTTACAGGTAGGTGTGAGAGG + Intergenic
1024555452 7:50599603-50599625 AGGCTCCAGGGAGGACGGAGAGG + Intronic
1024635806 7:51289370-51289392 AGGATCCAGGGAGGGCTGAGAGG - Intronic
1024676290 7:51640634-51640656 AGACTGCAGGAAGCAGTGAGTGG - Intergenic
1025002778 7:55331266-55331288 AGGGTGGAGAGTGGACTGAGAGG + Intergenic
1025146939 7:56513481-56513503 AGGCTGCAGGGAGGCTTGAAGGG - Intergenic
1025198682 7:56949359-56949381 AGGGAGGAGGGAGGAGCGAGAGG - Intergenic
1025198701 7:56949410-56949432 AGGGTGAAGGGAGGAGGGAAGGG - Intergenic
1025605523 7:63037671-63037693 AGGGAGAAGGGAGGACAGAGTGG - Intergenic
1025673247 7:63627521-63627543 AGGGTAAAGGGAGGAGGGAAGGG + Intergenic
1025673266 7:63627572-63627594 AGGGAGGAGGGAGGAGCGAGAGG + Intergenic
1025790175 7:64681256-64681278 GGAGGGCAGGGTGGAGTGAGTGG - Intronic
1025998419 7:66543012-66543034 AGGCTACAGGGAGGGGAGAGCGG + Intergenic
1026129127 7:67606013-67606035 AGGGTGCAGGGAACAGTGCGGGG - Intergenic
1026315636 7:69224884-69224906 AGGGTGGAGGGAGGTGGGTGAGG - Intergenic
1026560901 7:71447829-71447851 AGGTTGCTGAGAGGACTGAGAGG - Intronic
1026817182 7:73522035-73522057 TGGGGGAAGGGAGGGGTGAGAGG + Exonic
1027189875 7:75990341-75990363 AGGGTGCAGAGATGAGAGTGAGG - Intronic
1027219523 7:76205012-76205034 AGGGTTCAATGAGGAGAGAGGGG - Intronic
1027235130 7:76293494-76293516 ACAGTGGAGGTAGGAGTGAGGGG - Intergenic
1027698324 7:81437468-81437490 AGCTTGCAGGGAGGTGTGGGGGG - Intergenic
1028136682 7:87230278-87230300 AGGGTGCCAGGAGGAGGGCGAGG - Intergenic
1028214630 7:88116403-88116425 AGGGTGCAGGGATCCGTGAAAGG + Intronic
1028273368 7:88820602-88820624 ATGGTGAAGGGAAAAGTGAGTGG + Intronic
1028290283 7:89056982-89057004 AGAGTGCAGGGAGAAGTCATGGG + Intronic
1028986263 7:97011077-97011099 AGGGAGGAGGGAGGAAAGAGAGG - Intergenic
1028988422 7:97025299-97025321 AAGGTGCAGGGAGTGGGGAGCGG + Intergenic
1029123381 7:98282304-98282326 AGGGTGCAGGGAGGAGAAATCGG - Intronic
1029181317 7:98703995-98704017 AGGTTGGAGGGAGGATAGAGGGG + Intergenic
1029238515 7:99143146-99143168 CGGGAGCAGAGAGGAGCGAGGGG + Intronic
1029412885 7:100426951-100426973 AGGGGGAAGGGAGGAGGGGGAGG - Intronic
1029704819 7:102270659-102270681 AGGGTGCAGGGCTGAGTGGTTGG - Intronic
1029730474 7:102434803-102434825 AGGGGGCAGGGAGATGTGGGTGG - Intronic
1030638266 7:111974611-111974633 AGGGTGAAGGCAGAAGTGAGAGG + Intronic
1031479229 7:122258083-122258105 AGGGTGTAGGGAGAAGGGATCGG + Intergenic
1031523674 7:122797718-122797740 TGGAGGCAGGGAGGAGGGAGAGG + Intronic
1031923255 7:127616237-127616259 AAGGGGCTGGGAGGATTGAGAGG + Intergenic
1032237157 7:130135150-130135172 AGTGTACAGGGTGGAGTCAGAGG + Exonic
1032399046 7:131610983-131611005 AGGGCGCAGGGAGGCCTGAGTGG - Intergenic
1032420388 7:131774617-131774639 AGGGAGCTGGGAGGAGTGGGCGG - Intergenic
1032655807 7:133928599-133928621 AGGGTGCAGCGTGGAGCGGGAGG - Intronic
1033192423 7:139293941-139293963 AGTGTGCAGGCAGAGGTGAGTGG - Exonic
1033275308 7:139967222-139967244 AGGGTGGAGGGAGGAAGGAGAGG - Intronic
1033368808 7:140690854-140690876 ACGGGGCAGGGAGGAATGGGAGG + Intronic
1033478657 7:141716346-141716368 AGGGAGGAGGGAGGAGAGAGAGG - Intronic
1033852798 7:145517645-145517667 AGGCGGCAGGATGGAGTGAGTGG + Intergenic
1034051594 7:147989831-147989853 GGGCTGTAGGGAGGTGTGAGTGG - Intronic
1034202354 7:149290341-149290363 AGGGTTCCGGGAGGAGCGACGGG + Intronic
1034422178 7:150995913-150995935 AGGGTGCAGGGATGGGACAGGGG - Intronic
1034447334 7:151120374-151120396 AGAGGGCAGGGAGGACTGTGGGG - Intronic
1034569066 7:151940733-151940755 AGGGTGCAGGGCGGAGTGGGGGG + Intergenic
1034620237 7:152451218-152451240 AGGCTGCAGTGAGCAGTGATTGG + Intergenic
1034854437 7:154528858-154528880 CAGGTGCAGGGAGCAGTGTGAGG + Intronic
1034950005 7:155290709-155290731 ATGGAGCAGGAAGGAGTGAGGGG - Intergenic
1035241322 7:157531629-157531651 AGGGTGCAGGGTGGGAGGAGAGG - Intergenic
1035275546 7:157746074-157746096 GGGGTGTAGGGAGGACTGTGGGG - Intronic
1035389727 7:158496700-158496722 AGGCTGCAGGGAAGGGGGAGGGG - Intronic
1035389769 7:158496795-158496817 AGGCTGCAGGGAAGGGGGAGGGG - Intronic
1035389787 7:158496836-158496858 GGGGTGCAGGGAAGAGCAAGGGG - Intronic
1035389847 7:158496989-158497011 AGGGCGCAGGGAAGGGGGAGGGG - Intronic
1035389857 7:158497009-158497031 AGGGCGCAGGGAAGGGGGAGAGG - Intronic
1035389898 7:158497107-158497129 AGGGAGCAGGGAAGGGGGAGGGG - Intronic
1035459682 7:159031178-159031200 AGGGGGTGGGGATGAGTGAGGGG + Intronic
1035625532 8:1067949-1067971 AGGAGGGAGGGAGGAGTGGGCGG - Intergenic
1035774543 8:2178003-2178025 CGGGAGGAGGGAGGAGGGAGGGG + Intergenic
1036171942 8:6495714-6495736 AGGGTGGATGGAGGAGATAGTGG + Intronic
1036953002 8:13159454-13159476 AGGGTGGAGAGAGGACTTAGTGG + Intronic
1037479924 8:19294972-19294994 ACAGTGCAGGGAGGAGTGGTTGG + Intergenic
1037696856 8:21230959-21230981 AGAATCCAGTGAGGAGTGAGGGG + Intergenic
1037822314 8:22140916-22140938 TGGGTGCATGATGGAGTGAGAGG + Intronic
1037987550 8:23299304-23299326 AGGGTGCAGGGAGGACCTGGCGG + Intronic
1038151467 8:24944755-24944777 AGCCTGCAGATAGGAGTGAGTGG - Intergenic
1038179222 8:25210880-25210902 AGGGGGAAGGGAGGAGGGAGAGG + Intronic
1038259743 8:25982412-25982434 AGGGTGAAGGGATGAGGGAGCGG - Intronic
1038649569 8:29390244-29390266 TGGGTGCAGAGAGGATTGTGGGG + Intergenic
1038875005 8:31538833-31538855 AGGGTGGATGGTGGAGTGAAGGG + Intergenic
1039405591 8:37309751-37309773 AGGGTGCAGGGAGGGAAGTGAGG - Intergenic
1039450544 8:37671220-37671242 GGGGTGGAGGGAGGATTGACTGG + Intergenic
1039464063 8:37770893-37770915 AAGGTGATGGGAGGAGGGAGCGG + Intronic
1040286635 8:46103823-46103845 GGGCTGCAGGGTGGCGTGAGGGG - Intergenic
1040298210 8:46174222-46174244 GGGGTGCAGGGTGGTGTGGGAGG + Intergenic
1040331696 8:46388935-46388957 GGGCTGCAGGGTGGCGTGAGTGG + Intergenic
1040334264 8:46408139-46408161 GGGAGGCAGGGTGGAGTGAGAGG + Intergenic
1040336851 8:46420443-46420465 AGGCTGCAGTGTGGAGTGGGTGG + Intergenic
1040338656 8:46428902-46428924 GGGATGCAGGGTGGAGTGAGTGG + Intergenic
1041532836 8:58891021-58891043 AAAATGCAGGGAGGAGAGAGAGG - Intronic
1041901219 8:62985217-62985239 AAGAGGCAGGGTGGAGTGAGTGG - Intronic
1042106917 8:65337917-65337939 AGGGTGAAGGCAGGAGTGATAGG + Intergenic
1042574176 8:70199568-70199590 ACAGTCCAGGGAGCAGTGAGGGG + Intronic
1042581569 8:70284840-70284862 AGGGAGAAGGGAGAAGGGAGAGG + Intronic
1042781279 8:72493848-72493870 AGGGTCCGTGGAGAAGTGAGTGG - Intergenic
1042916967 8:73884870-73884892 AGGTTGCAGGGGCGATTGAGAGG + Intergenic
1043019560 8:74984224-74984246 GGGGAGCTGGGAGGACTGAGGGG + Intergenic
1043699903 8:83272751-83272773 GGGGTGCAGGGACGGGGGAGGGG - Intergenic
1043947814 8:86274253-86274275 AGGCTGCAGGGAGCTGTGATTGG - Intronic
1044074663 8:87804820-87804842 AGGGTGGAGGCAGGAGTGAATGG + Intergenic
1044983228 8:97736342-97736364 AGGGTGAAGGGAAGGGGGAGGGG + Intergenic
1045284881 8:100781894-100781916 AGGGTGCATGGGGAAGGGAGAGG - Intergenic
1045514846 8:102849887-102849909 AGGCTCCAGGGAGCAGTGTGTGG - Intronic
1045833640 8:106494179-106494201 AGGGGGCAGGTAGGGGTGAAAGG - Intronic
1046685518 8:117221713-117221735 AGGGGACAGGAAGGAGTGGGAGG + Intergenic
1046946481 8:119978942-119978964 AGGGAGCAGGGAGCAGGGAGAGG - Intronic
1047164416 8:122421194-122421216 TGGGGGCAGGGAGGACAGAGGGG + Intergenic
1047276972 8:123413233-123413255 AGGAAGCAGGGAGGAGTTGGGGG - Intronic
1047527641 8:125647136-125647158 AAGGTGGAGGGAGGAGAGATGGG + Intergenic
1047933519 8:129752771-129752793 ACTGTGCTGCGAGGAGTGAGGGG - Exonic
1048044898 8:130764328-130764350 AGGGTGCAGGATGGAGGGGGAGG + Intergenic
1048152107 8:131904173-131904195 AGGGCGAAGGGTGGAGGGAGCGG - Exonic
1048178182 8:132171506-132171528 GGGTTGCAGGGAGCAGTGAGAGG - Intronic
1048725091 8:137374424-137374446 AGGCTGGAGTGAGGAGTGAGTGG + Intergenic
1048772145 8:137906210-137906232 AGGATTCTGGGAGGAGTCAGGGG + Intergenic
1048797882 8:138168072-138168094 AGCGTCCAGGGAAGAGTCAGAGG + Intronic
1048925138 8:139264867-139264889 AGGGAGGAGGGAGGCGGGAGGGG - Intergenic
1049049595 8:140183981-140184003 AGGGAGGAGGGAGGAGGGAGGGG + Intronic
1049231745 8:141488327-141488349 AGGAAGGAGGGAGGAATGAGAGG - Intergenic
1049252531 8:141596919-141596941 AGGGTGGTGGGTGGGGTGAGGGG - Intergenic
1049289032 8:141791840-141791862 GGGGAGCAGGGCAGAGTGAGTGG - Intergenic
1049356821 8:142193141-142193163 AGGGAGAAGGGAGGAGCGGGAGG + Intergenic
1049402233 8:142433588-142433610 AGGGTTCGGGGATGAGGGAGGGG + Intergenic
1049452622 8:142670159-142670181 AGGGTGGGGGGAGGCGTGGGAGG + Intronic
1049477096 8:142801862-142801884 AGGGTGGATGGGTGAGTGAGTGG + Intergenic
1049478854 8:142810522-142810544 GGGGTGGAGGGAGGCGTGAAGGG - Intergenic
1049521892 8:143095590-143095612 GGGGTGGGGGGAGGAGGGAGAGG - Intergenic
1049541711 8:143211727-143211749 AGGGCGCAGGGAGGCGGGTGGGG + Intergenic
1049567605 8:143349302-143349324 AGGGGGCAGGGGGGTGGGAGGGG - Intronic
1049575655 8:143388607-143388629 AGGGTGCTGGGCGGGGTGTGGGG + Intergenic
1049921166 9:365848-365870 GGGGTGCAGGGATGTGTGTGGGG - Intronic
1049956099 9:694714-694736 AGGCTGCACGTAAGAGTGAGGGG - Intronic
1049970810 9:820457-820479 AGGGTGCAGGCAGGGCAGAGAGG + Intergenic
1049986065 9:952771-952793 TGGGATCAGGGAGGAGTGTGTGG + Intronic
1050460751 9:5875441-5875463 TGGGTGGAGAGAGGAGTTAGAGG + Intergenic
1050628784 9:7536983-7537005 AAGGTGGTGGTAGGAGTGAGGGG - Intergenic
1050673379 9:8023862-8023884 AGTGTGAAGGGAAGAGTGTGTGG - Intergenic
1051459363 9:17294856-17294878 AGGGAGGAGGGCGGAGGGAGTGG + Intronic
1051746735 9:20301903-20301925 AGGGTTTAGCGAGGAGGGAGAGG - Intergenic
1053612518 9:39729202-39729224 GGGGGGCAGGGGGGAGGGAGGGG + Intergenic
1053696667 9:40645564-40645586 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1053799757 9:41756994-41757016 AGGGGGGAGGGAGGACAGAGGGG - Intergenic
1053870550 9:42487173-42487195 GGGGGGCAGGGGGGAGGGAGGGG + Intergenic
1054145454 9:61557940-61557962 AGGGGGGAGGGAGGACAGAGGGG + Intergenic
1054188167 9:61969049-61969071 AGGGAGGAGGGAGGACAGAGGGG - Intergenic
1054240996 9:62613190-62613212 GGGGGGCAGGGGGGAGGGAGGGG - Intergenic
1054307917 9:63444795-63444817 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1054555129 9:66647715-66647737 GGGGGGCAGGGGGGAGGGAGGGG - Intergenic
1054650349 9:67619527-67619549 AGGGGGGAGGGAGGACAGAGGGG + Intergenic
1055416232 9:76086423-76086445 AGGATGTAGGAAGGAGTGACCGG + Intronic
1055979555 9:81988687-81988709 AGGGTGCAGGGAGCAACAAGAGG - Intergenic
1055986886 9:82061985-82062007 TGGATGCAGAGAGGGGTGAGGGG - Intergenic
1056143622 9:83707943-83707965 AAGGGGCAGGGAGGAGGAAGCGG - Exonic
1056622195 9:88223812-88223834 AGGGAGCAGAGAGGAGAGGGAGG + Intergenic
1057044771 9:91877096-91877118 AGGGTGCTGGGAAGACTGTGGGG + Intronic
1057226440 9:93295763-93295785 AAGGTGAAGGGAGGATGGAGAGG - Intronic
1057380686 9:94564661-94564683 AGGGTGGAGGGAGGGAGGAGGGG + Intronic
1057510897 9:95678731-95678753 TGGGTGCAGGGAGCAGGGAGAGG + Intergenic
1057601589 9:96462856-96462878 AGGCTGCAGTGAGCAGTGATTGG + Intronic
1057601724 9:96464050-96464072 ACGGTGCAGGGAGGAGTGGGTGG + Intronic
1057715892 9:97495618-97495640 AGGGAGCAGTGAGGAGTCAAAGG - Intronic
1058025386 9:100137316-100137338 AGGGTCTGGGGAGGTGTGAGAGG - Intronic
1058164780 9:101607018-101607040 GGTGTGCAGGGAGGAATGTGGGG + Intronic
1058858969 9:109095819-109095841 AGGGTGGTGAGAGGGGTGAGAGG - Intronic
1059277058 9:113106334-113106356 TGTGTGCAGGGAGGGGAGAGGGG + Intergenic
1059279193 9:113118217-113118239 TGTGTGCAGGGAGGGGAGAGGGG - Intergenic
1059446853 9:114343403-114343425 GGGGTGAAGGGAGGATGGAGGGG + Intronic
1059810575 9:117852006-117852028 AGGTTGCAGGGAGGTGTGGAGGG + Intergenic
1059862949 9:118485434-118485456 AGGGAGGAGGGAGGAGGGAGTGG + Intergenic
1060045582 9:120337504-120337526 AGGAAGCAGCGTGGAGTGAGGGG - Intergenic
1060202601 9:121660432-121660454 ATGGTGCAGGGAGAAGAAAGTGG + Intronic
1060389556 9:123267497-123267519 AGCCTGCAGGGAGGCGGGAGGGG - Intronic
1060390186 9:123270033-123270055 AGGGTCAAGGAAGGTGTGAGTGG - Intergenic
1060661463 9:125407680-125407702 TGGGGGCTGGGTGGAGTGAGAGG + Intergenic
1060730443 9:126033664-126033686 AGGGTGCAGAGGGCAGAGAGGGG + Intergenic
1060900947 9:127257736-127257758 GGGGTGCAGGGAGAAGAGAAAGG + Intronic
1060972927 9:127749078-127749100 TGTGTGCAGGGAGGAATGGGAGG - Intronic
1061213130 9:129204808-129204830 GGGGTGCGGGGAGGGGTGAGGGG + Intergenic
1061246141 9:129402105-129402127 AGGGAGGAGGGAGGAGCGTGGGG - Intergenic
1061390602 9:130315310-130315332 AGGGCAGAGGGAGGAGGGAGGGG - Intronic
1061489855 9:130938891-130938913 AGGGACGAGGGAGGAGAGAGAGG - Intronic
1061630809 9:131871029-131871051 AAGGTGCAGGGCGGGGAGAGTGG + Intronic
1061805384 9:133134951-133134973 AGTTTGCAGGAAGGAGTGACTGG - Intronic
1061861671 9:133471667-133471689 AGGCTACGGGGAGGACTGAGAGG - Exonic
1062050495 9:134444379-134444401 AGGGGGAAGGAAGGAGGGAGGGG - Intergenic
1062050624 9:134444712-134444734 AGGGGGAAGGAAGGAGGGAGGGG - Intergenic
1062084312 9:134641094-134641116 AGGGAGTGGGCAGGAGTGAGGGG + Intergenic
1062388078 9:136322702-136322724 GGGGTGCATGGAGGACTGAGTGG + Intergenic
1062391550 9:136335941-136335963 GGATGGCAGGGAGGAGTGAGGGG - Intronic
1062463726 9:136672314-136672336 GGGCTGCAGGGCGGCGTGAGGGG - Exonic
1062481820 9:136755884-136755906 ATAGTGCAGGGAGCAGTGCGGGG + Intronic
1062481849 9:136756039-136756061 ACAGTGCAGGGAGCAGTGCGGGG + Intronic
1062540617 9:137040206-137040228 AGGGTGCAGGGCGGCGGGGGAGG + Intronic
1062573266 9:137195127-137195149 TGTGTGCAGGGAGGAGGGAGAGG - Intronic
1062578993 9:137221451-137221473 CGGGGGCAGGGAGGGGTGGGAGG + Intronic
1202779118 9_KI270717v1_random:19209-19231 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1185449573 X:275254-275276 AGGGGGGAGGGCGGAGTGTGGGG + Intergenic
1185575590 X:1169342-1169364 AGGGGGAAGGGAGGAGGAAGGGG + Intergenic
1185835926 X:3346027-3346049 AGGGGGAAGAGAGGAGGGAGAGG + Intronic
1186321117 X:8426494-8426516 AGGGTAGTGGGAGGAGAGAGTGG - Intergenic
1186510132 X:10124466-10124488 AGGTGGCAGGAAGGAGTGACAGG + Intronic
1186519405 X:10192481-10192503 ATGGTGCAGGTAGGAGAGCGTGG + Intronic
1186578974 X:10796726-10796748 AGTGTGGAGGGTGGAGTGTGTGG + Intronic
1186653246 X:11584921-11584943 AGGGTGGAGGGTGGAGGGTGGGG - Intronic
1187231816 X:17430627-17430649 AGGCTGCGGGGAGGAGTAAATGG - Intronic
1187539083 X:20173420-20173442 AGGGTGAAGAAAGGAGGGAGTGG - Intronic
1188034180 X:25297992-25298014 GGGGTGGAGGGAGGAGTTGGGGG + Intergenic
1189137279 X:38562301-38562323 AGGATGCAGGGAGGTGGGAAAGG - Intronic
1189563362 X:42213904-42213926 AGGGTGCAGAAAGATGTGAGAGG + Intergenic
1190065818 X:47241148-47241170 AAGGGGAAGGGAGGAGAGAGAGG - Intronic
1190116711 X:47630068-47630090 AGGTTGCTGGGAGGAGCGCGAGG - Intronic
1190414478 X:50167376-50167398 GGGGTGGGGGTAGGAGTGAGGGG + Intergenic
1190631720 X:52393724-52393746 GGGGTGGGGGGAGGGGTGAGGGG - Intergenic
1191103068 X:56753901-56753923 AGAGTGCATGGAGGAGTGTGAGG + Intergenic
1191720323 X:64223591-64223613 AGGGGTAAGGGAGGAGGGAGAGG - Intergenic
1192189648 X:68983159-68983181 AGAGTGCAGGGAGGAGTTTCAGG - Intergenic
1192428130 X:71095370-71095392 CGGGTGGAGGGAGGAGGAAGGGG + Intergenic
1192534982 X:71919635-71919657 AGAATGAAGGGAGGAGTCAGAGG - Intergenic
1192555013 X:72082261-72082283 AGGGTGCAGGGGCGAGGGTGGGG + Intergenic
1193040237 X:76997023-76997045 AGCTTGCAGGGAGGTGTGAAGGG - Intergenic
1193969407 X:88033336-88033358 GGGGTGGAGGGAGGGGGGAGGGG - Intergenic
1194262262 X:91710839-91710861 AGGGAGTTGTGAGGAGTGAGTGG - Intergenic
1194640524 X:96398787-96398809 AGCCAGCAAGGAGGAGTGAGGGG - Intergenic
1194960473 X:100229523-100229545 AGGGGGGAGGGAGGAATGAAGGG - Intergenic
1195431175 X:104791210-104791232 GGGGTGGAGAGAGGAGGGAGAGG - Intronic
1195523020 X:105852249-105852271 AGTCTGAAGGGAGGATTGAGGGG + Intronic
1195732858 X:107982838-107982860 GGGGTGATGGGAGGAGTGTGGGG - Intergenic
1195881801 X:109600716-109600738 AAGGGGCAGGGCGCAGTGAGAGG - Intergenic
1195939420 X:110155647-110155669 AGGGGGCAGGGAGAGGAGAGAGG - Intronic
1197628194 X:128827120-128827142 AGGGAGCAGGGAGGCCCGAGGGG - Intergenic
1197813540 X:130472871-130472893 AGGGTGGAGGGAGGAGGGAGAGG + Intergenic
1197891977 X:131277806-131277828 AGGGGGCAGGGTGGAGGGAAAGG - Intronic
1197962565 X:132022954-132022976 ACGTTGCAGGGAGGCGTGCGAGG - Intergenic
1198871759 X:141183176-141183198 AGGAGGCAGAAAGGAGTGAGTGG - Intergenic
1199305684 X:146264973-146264995 AGGTGGGAGGGAGGAGTGAGAGG + Intergenic
1199325948 X:146498621-146498643 AGAGAGAAGGGAGGAGAGAGAGG - Intergenic
1199816419 X:151401808-151401830 AGGCTGCAGTGAGCAGTGATTGG - Intronic
1199915088 X:152330700-152330722 GGGGTGCAGGGAGGGGGGAGGGG + Intronic
1199995392 X:153021586-153021608 AGGGAGGAGGGATGAGGGAGGGG - Intergenic
1200036430 X:153334462-153334484 AGAGTGCACGGTGGAGGGAGGGG + Intronic
1200068708 X:153517575-153517597 AGGAGGGAGGGAGGAGGGAGCGG - Intergenic
1200581556 Y:4955672-4955694 AGGGAGTTGTGAGGAGTGAGTGG - Intergenic
1201184054 Y:11380665-11380687 AGGGTGGAGGGTGGAAGGAGGGG + Intergenic
1201288588 Y:12400436-12400458 AGGCTGCAGGAAGCAGTGACTGG + Intergenic
1202628133 Y:56881489-56881511 AGGGAGGAGGCAGGAGTGTGGGG + Intergenic