ID: 1070830563

View in Genome Browser
Species Human (GRCh38)
Location 10:79415622-79415644
Sequence GAGGGTGCAGGGAGGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3517
Summary {0: 1, 1: 0, 2: 12, 3: 227, 4: 3277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830563_1070830569 -7 Left 1070830563 10:79415622-79415644 CCCTCACTCCTCCCTGCACCCTC 0: 1
1: 0
2: 12
3: 227
4: 3277
Right 1070830569 10:79415638-79415660 CACCCTCTCCCAGGTCTGAAAGG No data
1070830563_1070830574 8 Left 1070830563 10:79415622-79415644 CCCTCACTCCTCCCTGCACCCTC 0: 1
1: 0
2: 12
3: 227
4: 3277
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data
1070830563_1070830575 11 Left 1070830563 10:79415622-79415644 CCCTCACTCCTCCCTGCACCCTC 0: 1
1: 0
2: 12
3: 227
4: 3277
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830563 Original CRISPR GAGGGTGCAGGGAGGAGTGA GGG (reversed) Intronic
Too many off-targets to display for this crispr