ID: 1070830564

View in Genome Browser
Species Human (GRCh38)
Location 10:79415623-79415645
Sequence AGAGGGTGCAGGGAGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830564_1070830575 10 Left 1070830564 10:79415623-79415645 CCTCACTCCTCCCTGCACCCTCT No data
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830564_1070830574 7 Left 1070830564 10:79415623-79415645 CCTCACTCCTCCCTGCACCCTCT No data
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data
1070830564_1070830569 -8 Left 1070830564 10:79415623-79415645 CCTCACTCCTCCCTGCACCCTCT No data
Right 1070830569 10:79415638-79415660 CACCCTCTCCCAGGTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830564 Original CRISPR AGAGGGTGCAGGGAGGAGTG AGG (reversed) Intronic
No off target data available for this crispr