ID: 1070830566

View in Genome Browser
Species Human (GRCh38)
Location 10:79415630-79415652
Sequence ACCTGGGAGAGGGTGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 7, 3: 79, 4: 732}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830566_1070830574 0 Left 1070830566 10:79415630-79415652 CCTCCCTGCACCCTCTCCCAGGT 0: 1
1: 0
2: 7
3: 79
4: 732
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data
1070830566_1070830575 3 Left 1070830566 10:79415630-79415652 CCTCCCTGCACCCTCTCCCAGGT 0: 1
1: 0
2: 7
3: 79
4: 732
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830566_1070830577 25 Left 1070830566 10:79415630-79415652 CCTCCCTGCACCCTCTCCCAGGT 0: 1
1: 0
2: 7
3: 79
4: 732
Right 1070830577 10:79415678-79415700 GCAGCTGCACTCCCAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830566 Original CRISPR ACCTGGGAGAGGGTGCAGGG AGG (reversed) Intronic
900092277 1:925639-925661 GCCGGGGAGAGGGTGGAGCGCGG + Intronic
900297440 1:1959025-1959047 TCCTGGGAGGGGGTGCAGGTTGG - Intronic
900563001 1:3317284-3317306 ACCTGGGAGAAGTGACAGGGAGG + Intronic
900700459 1:4045485-4045507 AGCAGGGAGAGGCTGCAGAGGGG + Intergenic
900853357 1:5161569-5161591 CACTGGGAGGGGCTGCAGGGAGG + Intergenic
900896997 1:5490222-5490244 GCCTTTGAGAGGGTGGAGGGTGG + Intergenic
900919822 1:5663045-5663067 GCCTGGGTGTGGGTGGAGGGAGG - Intergenic
901088517 1:6626347-6626369 GCCTGGGAGGGGGTCCAGGTAGG - Intronic
901802340 1:11715502-11715524 ATCTGGAAGAGGGAGAAGGGAGG + Intronic
901932323 1:12603494-12603516 ACGTGGGAGATGGAGCAGGGAGG - Intronic
902360002 1:15937235-15937257 AGCTGGGAGGGCGGGCAGGGTGG - Exonic
902368121 1:15990446-15990468 TCCTGGGCCAGGGTGCTGGGAGG - Intergenic
902823887 1:18959441-18959463 GCATGGGAGTGGGTGCAGAGGGG + Intergenic
903323419 1:22555845-22555867 ACCTGGGTGAGGGGCCAGGTCGG - Intergenic
903859091 1:26354401-26354423 CCCTGGGGAAGGATGCAGGGTGG + Intergenic
903859576 1:26356689-26356711 AGCTGGGAGAGGGAACAGAGAGG - Intergenic
903861506 1:26367541-26367563 GCCTGGCAGAGGCTGGAGGGTGG - Intronic
904043605 1:27598075-27598097 ACCTGGGGGAGGGTGCCTTGGGG - Intronic
904408753 1:30312105-30312127 GGCTGGGAGAGGGTGGAGGAAGG + Intergenic
904884564 1:33726469-33726491 ACGTGGGAGGGAATGCAGGGTGG - Intronic
905461646 1:38126343-38126365 ACCTGGGAGCGGGTGGAGGGTGG - Intergenic
905477868 1:38241656-38241678 CCCTGGGAGAGTGAGCAGAGGGG - Intergenic
905795934 1:40816669-40816691 AGCAGGGAGAGGATGTAGGGAGG - Intronic
906535437 1:46548596-46548618 ACCTGGGGGAGGGGAAAGGGAGG + Intronic
907068878 1:51516954-51516976 TGCTGGGAGAGTGGGCAGGGTGG + Intronic
907097300 1:51793386-51793408 ACCTAGAAGAGGCTGCAGGTTGG + Intronic
907113365 1:51947729-51947751 AGCTGGGAGAGGGTGTATTGTGG - Intronic
907308836 1:53528023-53528045 GGTAGGGAGAGGGTGCAGGGAGG + Intronic
908395871 1:63725271-63725293 ACCTGGGGGATGGTGGAGGGTGG - Intergenic
909270822 1:73621320-73621342 GCCTGTCAGAGGGTGAAGGGGGG + Intergenic
909276343 1:73691277-73691299 GCCTTTGAGAGGGTGGAGGGTGG - Intergenic
910058596 1:83061756-83061778 ATATGGGAGAGGATGCATGGTGG + Intergenic
910140179 1:84018464-84018486 ACCTGGTGGAGGGGGCAGGGTGG + Intergenic
910940035 1:92523312-92523334 GCCAGGGTGAGGGTGAAGGGGGG - Intronic
912468901 1:109893049-109893071 AACTAGGAGAAGGTGGAGGGAGG + Intergenic
913077196 1:115350907-115350929 GCCTTGGAGGGGATGCAGGGAGG - Intergenic
915024582 1:152815595-152815617 GCCTGTCAGAGGGTGGAGGGTGG + Intergenic
915108344 1:153547915-153547937 ACTTGGGAGAGGAAGGAGGGAGG - Intronic
915471328 1:156127195-156127217 ACTTGGGGGCGGGGGCAGGGAGG + Intronic
915506005 1:156356957-156356979 AGCTGGGGGAGGGAGCAGGGTGG - Intronic
915587605 1:156852576-156852598 GCCTGGGAGTGTGTGCAGGGAGG + Intronic
916387565 1:164293005-164293027 ACCTTTGAGAAGGTGGAGGGTGG - Intergenic
916440428 1:164819564-164819586 ACCTGGGAGGGAGTGCATGAAGG - Intronic
917091783 1:171360064-171360086 CCCTGGGACAGAGTGCATGGGGG + Intergenic
917455411 1:175181959-175181981 CCCTGGGAGAGGGGGTCGGGTGG - Intronic
917512546 1:175680295-175680317 AAAAGGGAGAGGGGGCAGGGTGG + Intronic
918001506 1:180502015-180502037 AGCAGGGAGAGGGTGGATGGGGG - Intronic
918248894 1:182684459-182684481 ACCTGGGAGAGGGTGGCAGAGGG + Intronic
918320336 1:183358260-183358282 ACCTGTCAGAGGGTGGAGGGTGG + Intronic
918515542 1:185358932-185358954 AGCTGGGGGAGGCTGCAGGCAGG - Intergenic
918704896 1:187647652-187647674 GCCTGGGCCTGGGTGCAGGGAGG + Intergenic
919408067 1:197209229-197209251 ACCTGGGAGAGGGAGCAAATCGG - Intergenic
919704155 1:200660377-200660399 ACCTGGGAGAGAGCTCAGGCTGG + Intronic
920041711 1:203102183-203102205 CCCTGGGAGTGGGTGCTGGCAGG + Intronic
920055232 1:203186393-203186415 GCTTGGGGGAGGGAGCAGGGCGG - Intronic
920279771 1:204834167-204834189 ACCAGGGAGAAGGTGGGGGGAGG - Intronic
920371297 1:205481065-205481087 GGCTGGGGGAGGGGGCAGGGTGG - Intergenic
920378419 1:205521927-205521949 AGCTGGGAGCGGGTGCAGGGCGG + Intronic
920593518 1:207245663-207245685 ACCTGGGAGACGGTGTAAGAGGG - Intergenic
920612406 1:207454480-207454502 AGCTGGGAGGGGGAGCACGGAGG + Intronic
920676351 1:208041080-208041102 TGCAGGGAGAGGGTGCTGGGAGG - Intronic
921011907 1:211150160-211150182 ACATGGCAGAAGGTGAAGGGGGG + Intergenic
921377208 1:214486758-214486780 GAATGGGAGAGGGTTCAGGGAGG - Intronic
921672992 1:217946863-217946885 CCGTGGGAGATGGAGCAGGGAGG + Intergenic
921806597 1:219462252-219462274 CCATGGAAGAGGGTACAGGGTGG + Intergenic
921860605 1:220038760-220038782 ACCAGGAAGTGGGCGCAGGGAGG + Intronic
922034366 1:221833984-221834006 ACCTGAGACAGGGGGCAGGCTGG + Intergenic
922564766 1:226594499-226594521 ACCTGGGAGGCAGTGCAGAGGGG + Intronic
922582738 1:226710790-226710812 GCCTGGGTGAAGGTTCAGGGAGG - Intronic
922651639 1:227345030-227345052 CCCTGGGATGGGGTGCAGTGGGG - Intergenic
922777396 1:228221823-228221845 GCCTGGGGCAGGGTGGAGGGTGG - Intronic
923160246 1:231308704-231308726 ACCAGGGAGATGACGCAGGGAGG - Intergenic
924707919 1:246513264-246513286 TCCTGGGCCAGGGTGCCGGGAGG + Intergenic
1062860257 10:805066-805088 ACCTGGGAGACGGGGGAGGGCGG - Intergenic
1064256579 10:13747639-13747661 ACGTGGGAGCTGGTGGAGGGAGG + Intronic
1064428947 10:15254981-15255003 CCTTGTGAGAGGGAGCAGGGTGG - Intronic
1065323198 10:24527849-24527871 ACCTCTCAGAGGGTGGAGGGTGG - Intronic
1065837287 10:29670004-29670026 ACCTGGGAGGCTGAGCAGGGAGG + Intronic
1066007295 10:31157452-31157474 AACTTGGAGAGGAGGCAGGGAGG - Intergenic
1066756302 10:38716221-38716243 GGCTGTGAGAGGGTGCAGAGAGG + Intergenic
1067161237 10:43826417-43826439 AGCTGGGGGAGCGTGCAGGCTGG - Intergenic
1067249352 10:44574184-44574206 ACTTGGGAGAGGCAGAAGGGTGG + Intergenic
1067553297 10:47250031-47250053 CCCTGGGAGATGCTCCAGGGTGG + Intergenic
1067692452 10:48510558-48510580 ACAAGGATGAGGGTGCAGGGAGG - Intronic
1067946027 10:50688450-50688472 ACCTGGGTGTGTGAGCAGGGAGG - Intergenic
1067962383 10:50868977-50868999 ACCTTTCAGAGGATGCAGGGTGG + Intronic
1068757853 10:60674419-60674441 AGGTGAGAGAGGGAGCAGGGAGG + Intronic
1070830566 10:79415630-79415652 ACCTGGGAGAGGGTGCAGGGAGG - Intronic
1070881338 10:79853450-79853472 ACCTGGGTGTGTGAGCAGGGAGG - Intergenic
1071450186 10:85786590-85786612 CCCTGGGTGAGGCAGCAGGGTGG - Intronic
1071647914 10:87369766-87369788 ACCTGGGTGTGTGAGCAGGGAGG - Intronic
1072157397 10:92736446-92736468 TCTTGGGAGAGGGTGCAGTGAGG - Intergenic
1072453169 10:95555267-95555289 TCCTGGTGGGGGGTGCAGGGGGG + Intronic
1073292179 10:102418857-102418879 CCCTGGGAGAGGGCGGGGGGTGG - Exonic
1073459543 10:103658802-103658824 ACCTGAGAGAGAGCTCAGGGAGG + Intronic
1073491979 10:103858673-103858695 ACATGGGAGAGGAGGTAGGGCGG - Intergenic
1073539024 10:104303104-104303126 GCCTATCAGAGGGTGCAGGGTGG - Intronic
1074158864 10:110820865-110820887 TGCTGGGAGAGGGTGCTTGGGGG + Intronic
1074739835 10:116475275-116475297 ACCTATCAGAGGGTGAAGGGTGG + Intronic
1075087299 10:119422170-119422192 AGCTGGCAGAGGGTGAATGGTGG + Intronic
1075196528 10:120364298-120364320 GCCTTGGAGAGGCTGAAGGGAGG + Intergenic
1075357305 10:121792086-121792108 GGCTGGGAGAGGGTTCAAGGAGG + Intronic
1076102920 10:127797471-127797493 GGCTGGGGGAGGGTGCAGGATGG - Intergenic
1076238592 10:128884649-128884671 TCCTGGGAGAGGGAGGTGGGAGG - Intergenic
1076841238 10:133046705-133046727 AGCTGGGAGATGGGACAGGGCGG - Intergenic
1077014397 11:393400-393422 ACATGAGTCAGGGTGCAGGGGGG - Intronic
1077182748 11:1223913-1223935 GCTTGGGAGGGGGTGGAGGGCGG - Intronic
1077318166 11:1928399-1928421 GCCAGGGAGAGGTAGCAGGGGGG + Intronic
1077367073 11:2165604-2165626 GGCTGGGGGACGGTGCAGGGAGG - Intronic
1077922102 11:6649365-6649387 ATCTGGCAGTGTGTGCAGGGTGG + Intronic
1077964708 11:7117019-7117041 ACCTGGGATGGGGTGGAGGAGGG + Intergenic
1078138255 11:8670344-8670366 ACCTGCTTGAGGGTGGAGGGTGG - Intronic
1078550917 11:12280148-12280170 ACCTGGGTGGGGGTGAGGGGTGG - Intronic
1078594590 11:12674995-12675017 ACCTCGGAGGGGGCGCGGGGAGG - Intronic
1078676059 11:13415493-13415515 ACTGGGGAGAAGGAGCAGGGAGG - Intronic
1078680762 11:13473542-13473564 ATCTGGGAGAGGCTGCAGGGTGG - Intergenic
1078816624 11:14829145-14829167 GCCTGTCAGAGGGTGGAGGGTGG + Intronic
1079870634 11:25794159-25794181 ACCTGGAAGTGGGTGCAATGTGG + Intergenic
1080664952 11:34327717-34327739 ATCTGGGAGAGGGGGAAGAGTGG - Intronic
1081988818 11:47326663-47326685 AGCTGGGAGAGTGTGCTGTGTGG + Intronic
1082268690 11:50146011-50146033 ACCTGCCAGAGGGTTGAGGGTGG + Intergenic
1082287437 11:50333057-50333079 ACCTGCCAGAGGGTTGAGGGTGG - Intergenic
1083059170 11:59851467-59851489 GCCTATGAGAGGGTGGAGGGTGG - Intergenic
1083150908 11:60791159-60791181 ATTTGGGACAGGATGCAGGGTGG + Intronic
1083253446 11:61482567-61482589 ATCTGTGGGAGGGTGCAGGGAGG + Intronic
1083328498 11:61885850-61885872 ACCTGGGAGAGGGGAGAGGCAGG - Intronic
1083682443 11:64357802-64357824 CCCTGGGAGAGGGTGGGGGCGGG - Intergenic
1083811819 11:65110642-65110664 AAGAGGGCGAGGGTGCAGGGCGG + Intronic
1083871402 11:65490506-65490528 AGCTGGGAGAGGCAGCAGAGGGG - Intergenic
1084165730 11:67373888-67373910 TCCTGGGGGAGGGGGCGGGGAGG + Intronic
1084383072 11:68825819-68825841 AGCTGGGAGTGGATGCAGAGTGG + Intronic
1084406925 11:68979542-68979564 ACCTGGGGAAAGGTGCACGGGGG + Intergenic
1084478089 11:69400208-69400230 CCCTGGGAGTGGGGGTAGGGGGG + Intergenic
1084556195 11:69877573-69877595 CCCTGGAAGAAGGTGCTGGGTGG + Intergenic
1084834350 11:71791967-71791989 CCATGGGAGACAGTGCAGGGCGG + Intronic
1084972440 11:72779192-72779214 ACCTGGGAAAGGCTTCAGGCGGG - Intronic
1085188111 11:74593282-74593304 ACCTGGGATGGGGTGCGGGGAGG - Intronic
1085622194 11:78045933-78045955 AGCTGGGTGAGGACGCAGGGAGG + Intronic
1085789577 11:79485579-79485601 ACCTGAGAAAGAGAGCAGGGTGG + Intergenic
1086172841 11:83855986-83856008 GCCTGACAGAGGGTGGAGGGTGG - Intronic
1086288969 11:85283077-85283099 ACCTACTAGAGGGTGGAGGGTGG + Intronic
1087912771 11:103772780-103772802 ACCTGGGAGGGTGTGGTGGGAGG + Intergenic
1089015765 11:115163974-115163996 ACAAAGGAGATGGTGCAGGGAGG + Intergenic
1089078873 11:115760145-115760167 CCCGGGGAGCGGTTGCAGGGCGG + Intergenic
1089292895 11:117449192-117449214 ACCTGGGAGGAGGGGCAGGCGGG + Intronic
1089626271 11:119753054-119753076 AGCTGGGAGAGCCTGCATGGAGG - Intergenic
1090048509 11:123357677-123357699 ACCTGGGACTGGGTGTTGGGTGG - Intergenic
1091388381 12:109657-109679 TGCTGGGAAAGGGTGCAGTGCGG - Intronic
1091663422 12:2401056-2401078 AGCTGGGAGAGACTGAAGGGAGG - Intronic
1091684314 12:2550689-2550711 ACCTGGGGGGCGGGGCAGGGCGG + Intronic
1091708866 12:2722945-2722967 ACTTGCCAGAGGGTGCAGGCAGG - Intergenic
1092079695 12:5705492-5705514 ATCTGGCAGAGGGTGCAGCCTGG - Intronic
1092211677 12:6650651-6650673 TCCTGGGAGAGGGGGCAAGGTGG - Exonic
1092230246 12:6772267-6772289 CCCTGGGAGAGGGAGCAGTCTGG + Intergenic
1092408731 12:8238497-8238519 CCATGGGAGACAGTGCAGGGTGG - Intergenic
1092465229 12:8725602-8725624 CCCTGGCAGAGGCTGCAAGGGGG + Intronic
1092936476 12:13368502-13368524 GCCAGGGACTGGGTGCAGGGAGG + Intergenic
1093764448 12:22946668-22946690 ACATGGGAGAGGGTAAAGTGTGG + Intergenic
1094161221 12:27393030-27393052 AACTGGGAGAAGTGGCAGGGAGG - Intronic
1094798989 12:34008466-34008488 ACTTGGGGGAGAGTGTAGGGAGG - Intergenic
1095310652 12:40693062-40693084 ACCTGGGAGCGGTTGCGGAGAGG + Intronic
1096480705 12:51939000-51939022 ACCTGGGAGAGGCTGCTGGAAGG + Intergenic
1096480989 12:51940913-51940935 TGCTGGGAGAGAGAGCAGGGAGG + Intergenic
1096502478 12:52073213-52073235 ACCACGGAGAGAGTACAGGGTGG - Intronic
1097190518 12:57217217-57217239 GGCTTGGAGAGGGTGCCGGGCGG + Intronic
1097191756 12:57222713-57222735 GCCTGAGAGAGGGTGGAGGGAGG - Intronic
1098361814 12:69661725-69661747 ACCTGAAAGAGGGTTGAGGGAGG - Intronic
1098407224 12:70139443-70139465 ATCTGGGAGAAGCTGCAGGGTGG + Intergenic
1100280310 12:93112294-93112316 TGCTGGGAGACGGTGCTGGGCGG - Intergenic
1101593011 12:106139534-106139556 AGCTGGGGGAGGGGGCAGGGAGG + Exonic
1102979758 12:117232074-117232096 GCCTGGAAGATGGTGCAGGGCGG + Exonic
1103261517 12:119593224-119593246 ACCTGGGGGAGGGGGTCGGGGGG + Intergenic
1103717756 12:122955532-122955554 ACCTGGGAGGGGAGGCAGGAGGG + Intronic
1104072916 12:125362095-125362117 ACCTGGGAGCAGGTGCAGGCAGG - Intronic
1104341504 12:127954141-127954163 TCCTACCAGAGGGTGCAGGGTGG - Intergenic
1104654938 12:130567531-130567553 ACGGGGGAGAGGGAGGAGGGAGG + Intronic
1104873056 12:132014470-132014492 ACCTCGGAGAGGGTCAAAGGGGG - Intronic
1105355624 13:19656876-19656898 TCCTGGGAGACTGTGGAGGGTGG + Intronic
1105535180 13:21259333-21259355 ACCGGGGACGGGGTGCGGGGGGG + Intergenic
1106862005 13:33920057-33920079 CCCTGTGAGAGGGTGCAGAAGGG - Intronic
1107223601 13:38018677-38018699 GCCTGTCAGAGGGTGAAGGGTGG - Intergenic
1107682281 13:42864530-42864552 TCCTGGGAGATGGTGGTGGGAGG - Intergenic
1107779039 13:43879300-43879322 CCCTGGGAGCGGGCGCAGGGCGG - Exonic
1108065038 13:46568722-46568744 ACCTGGGAAGGGGTGCAGAGAGG + Intronic
1108229832 13:48325129-48325151 ACCTATCAGAGGGTGGAGGGTGG - Intronic
1108275135 13:48800703-48800725 AACTGGGGGAAGGAGCAGGGAGG + Intergenic
1109229192 13:59735940-59735962 GCCTGTCAGAGGGTTCAGGGTGG - Intronic
1110179670 13:72600503-72600525 ACCAAGGAGAAGGTGTAGGGTGG - Intergenic
1110333683 13:74301884-74301906 ACACGGGAGAGGGTGCTGGGCGG - Intergenic
1111148513 13:84216780-84216802 AGCTGGGAGAGTGTGTATGGAGG + Intergenic
1111408973 13:87849398-87849420 ACCTGGGAGGTGGAGCTGGGAGG + Intergenic
1112377873 13:98860666-98860688 GCGTGGGTGAGGGTGGAGGGTGG + Intronic
1113385795 13:109846714-109846736 ACCAGGGATGGGGTGGAGGGTGG + Intergenic
1113769462 13:112898939-112898961 CCCTGGGAGGGGGCACAGGGTGG - Intronic
1113980335 13:114269388-114269410 ACCAGGGTGAGGGTGCTGGGAGG + Intronic
1114263384 14:21055844-21055866 TCCTGGGACAGGGTGGTGGGAGG + Intronic
1114439417 14:22734087-22734109 ATATGGGAGAAGCTGCAGGGTGG - Intergenic
1114636470 14:24189879-24189901 ACATGGGAGAGGGTGGGGGCTGG - Intronic
1114683416 14:24506189-24506211 ACCTGGGAGAATGTGCCGGGTGG - Exonic
1114928609 14:27437731-27437753 ACCTTGTAGAGGGTGGAGGGTGG + Intergenic
1115712899 14:36070206-36070228 ACCTTGGAGAAGGTGAAGGAGGG - Intergenic
1117260068 14:54023083-54023105 CCGGGGGAGAGGGTGCAGTGGGG - Intergenic
1117785102 14:59275276-59275298 GCCTGTCAGAGGGTGAAGGGTGG + Intronic
1119155467 14:72406015-72406037 AAATGGGAGAGGGTGAAGGAAGG + Intronic
1119266062 14:73263921-73263943 ACCTGTCAGAGGGGGTAGGGGGG - Intronic
1119298495 14:73552476-73552498 GCCTGGGAAAGGGGCCAGGGTGG - Intronic
1119302792 14:73584663-73584685 GCCTGGGAAAGGGGCCAGGGTGG - Intergenic
1119568762 14:75651258-75651280 GCCTGGAAGAGGTTGCAGGTAGG + Exonic
1119706955 14:76788972-76788994 CCCTGGGAGAGGCAGAAGGGGGG - Exonic
1119728602 14:76937266-76937288 CCCTGGGAAAGGTGGCAGGGAGG - Intergenic
1119772246 14:77227537-77227559 ACTTGGGAGATGGTGCATGGAGG + Intronic
1119773417 14:77235402-77235424 ACCTGGGAGACTGTGATGGGTGG + Intronic
1120821100 14:88912609-88912631 AGCAGGGACAGGGTGCAGTGAGG + Intergenic
1120890275 14:89485217-89485239 ACCTGGGGGAGAGTGAGGGGTGG + Intronic
1121314944 14:92955496-92955518 CCCTGGCACAGGGTGGAGGGAGG + Intronic
1121641536 14:95487705-95487727 GGCTGGGAGAGGGTGTAGGTGGG - Intergenic
1122188190 14:100018225-100018247 CCCTCGGAGAGGGAGCAGTGAGG + Intronic
1122660306 14:103290591-103290613 ACCTGGGAGGGGCTCCAGGGAGG + Intergenic
1122954044 14:105061612-105061634 TCCTCGGGGAGGGTGCAGTGGGG + Intronic
1123701499 15:22917748-22917770 CCCAGGGAGAGGGTGCAGGCGGG + Intronic
1124435480 15:29645466-29645488 ACTTTGGTGAGGTTGCAGGGAGG - Intergenic
1124625190 15:31303639-31303661 ACCTGGGAGTGGGTGAGGGGAGG + Intergenic
1125751720 15:42033741-42033763 AGCAGGGAGAGGGTGCCAGGTGG - Intronic
1126340308 15:47634382-47634404 ACCTGGGAGAAGGAGGAGGAGGG + Intronic
1126675528 15:51156784-51156806 ACCTGGAGGAGGGGGCAGGGAGG + Intergenic
1126871137 15:52989355-52989377 GCCTAGAAGAGGGTGAAGGGTGG - Intergenic
1126871991 15:52999470-52999492 GCCTAGAAGAGGGTGGAGGGTGG + Intergenic
1127457182 15:59165756-59165778 ACCTGGGCTAGGGTGCCAGGAGG - Intronic
1127733356 15:61819862-61819884 TCCGGGGAGAGGGAGCAGGGAGG + Intergenic
1128109715 15:65068494-65068516 TTCTGGGAGAGGGGGCGGGGCGG + Intronic
1128337835 15:66798806-66798828 ACCCAGGAGATGGTGGAGGGAGG + Intergenic
1128776136 15:70321914-70321936 TCCTGGGAGCTGATGCAGGGTGG + Intergenic
1129169513 15:73799108-73799130 GGCTGGGAGCGGGTGCTGGGCGG - Intergenic
1129178345 15:73856039-73856061 ACCTCGGAGAGTTTGCAGGCAGG - Intergenic
1129296317 15:74602241-74602263 ACCTGGGGCAGGGGGCAGGGGGG - Intronic
1129663548 15:77566704-77566726 AGATGGGAGAGAGTGCAGGAGGG + Intergenic
1129686029 15:77686573-77686595 ACCTGTGAGAGGGTTGACGGTGG - Intronic
1129747022 15:78029579-78029601 AGCTGACAGTGGGTGCAGGGAGG + Intronic
1130378734 15:83354058-83354080 GCCTGTCAGAGGGTGGAGGGTGG - Intergenic
1130515857 15:84625256-84625278 AACTGGGCCAGGGAGCAGGGAGG + Intronic
1130540547 15:84817996-84818018 GACAGGGAGAGGGTGCTGGGGGG + Intronic
1130543130 15:84836211-84836233 AGCTGGGGGAGAGTGGAGGGAGG + Intronic
1131060337 15:89400259-89400281 GCCGGGGAGGGGGTGGAGGGGGG + Intergenic
1131565664 15:93483337-93483359 ACCTGGGGTAGGGTACAGGCAGG + Intergenic
1131599105 15:93828927-93828949 ACAGGGGAGAGGGTCCAGGGTGG + Intergenic
1131694343 15:94859092-94859114 GCCAGGTAGAGGGTGGAGGGTGG - Intergenic
1131809760 15:96160697-96160719 ACTTGGGAGCGGGTGGAAGGAGG + Intergenic
1132614701 16:834751-834773 AGCTGGCTGAGGGTGCTGGGTGG - Intergenic
1132740240 16:1408461-1408483 ACCTAGGAAAGGGTGCACAGTGG + Intronic
1132828991 16:1918439-1918461 GCCTGGGAGCGGGCGCGGGGCGG + Exonic
1132942053 16:2513357-2513379 ACTGGGGACAGGGTGGAGGGAGG + Intronic
1133349696 16:5093314-5093336 CCATGGGAGACAGTGCAGGGCGG - Intronic
1133900130 16:9966268-9966290 GCCTTGCAGAGGGTGGAGGGTGG - Intronic
1134038556 16:11050601-11050623 ATCTGGGAGAGGTGGCAGGGAGG + Intronic
1134062160 16:11205802-11205824 AACTGGGAGAGGATGGAGGGGGG + Intergenic
1134664601 16:16009719-16009741 CCCTGGGGGAGGTTCCAGGGCGG + Intronic
1134796611 16:17043195-17043217 GCCTGTCAGAGGGTGGAGGGTGG + Intergenic
1135259881 16:20971634-20971656 GCCTGGGAGTGGGTGTAGTGGGG + Intronic
1135404797 16:22190425-22190447 GCGTGGGCGAGGGTGCAGCGGGG - Exonic
1135418952 16:22291515-22291537 GCCTGGGAAGGGGTCCAGGGGGG - Intergenic
1135916086 16:26606779-26606801 ACCTGGACTAGGGTGTAGGGTGG - Intergenic
1135937216 16:26791666-26791688 ACCGGGGAGTGGCTGCTGGGAGG + Intergenic
1136069550 16:27779524-27779546 ATGTGGCAGAGAGTGCAGGGAGG - Exonic
1136111786 16:28068004-28068026 ACGTGGGATAGGGGTCAGGGAGG - Intergenic
1136398238 16:30004602-30004624 ATCTGGGAGAGGCTGCGGGCAGG + Intronic
1137270961 16:46901952-46901974 GCCAGGCAGAGGGTGCAGGGGGG - Intronic
1137707456 16:50545380-50545402 ACCAGGGTGAAGGTGGAGGGGGG + Intergenic
1138219453 16:55238502-55238524 ACCTGGGAAAGTGTGTAAGGTGG + Intergenic
1138660831 16:58515998-58516020 GCCCGGGAGAGCGTGCAGGCCGG + Exonic
1139582854 16:67883643-67883665 GGCTGGGAGAGCGGGCAGGGTGG - Exonic
1139923449 16:70473348-70473370 ACCAGGGTGAGTGTGCAGGCTGG + Exonic
1140048856 16:71462064-71462086 GGCTGGGAGAGGGAGCAGGGCGG - Exonic
1140132831 16:72179084-72179106 ACCTGGGAGAAGGTGGAGGAGGG - Intergenic
1141423284 16:83930824-83930846 ACCTGGGAGGAGGCACAGGGAGG + Intronic
1141437964 16:84011558-84011580 ATCTGGGATGGGGTGAAGGGTGG + Intronic
1142044211 16:87914700-87914722 ACGTGGGGGCGGGCGCAGGGCGG + Intronic
1142187103 16:88699731-88699753 ACCTAGGAGACAGGGCAGGGAGG + Exonic
1142210708 16:88807146-88807168 CACTGGGAGAGGCTGCAGGCGGG - Exonic
1142240635 16:88943148-88943170 ACGTGGGAGTGGGGGCAGGTGGG + Intronic
1142352432 16:89586371-89586393 AGCCGGGTGAGGGTGCAGTGGGG + Intronic
1142740701 17:1930332-1930354 GCCTGGGTGAGGGAGGAGGGGGG + Intergenic
1142805038 17:2367087-2367109 TCCTGGGAGAGTGTGGAAGGAGG - Intronic
1143350186 17:6282493-6282515 ACATGGGAGAGGCTGGAGAGGGG - Intergenic
1143525152 17:7467474-7467496 ACCTGGCAGAGGCTCCGGGGAGG - Intronic
1143756665 17:9072574-9072596 GCCTCGGAGAGGAGGCAGGGAGG + Intronic
1144093755 17:11881467-11881489 CTCTGGGAGAGGTTGCAGAGGGG + Intronic
1144848316 17:18231441-18231463 CCATGACAGAGGGTGCAGGGAGG - Intronic
1145037774 17:19553176-19553198 CCCTCGGAGAGGGTGGAGGGTGG + Intronic
1145269673 17:21398035-21398057 CCCTGGCAGTGGCTGCAGGGTGG - Intronic
1145760926 17:27425248-27425270 TCCTGGGCCAGGGTGCCGGGAGG - Intergenic
1145773659 17:27511361-27511383 GGCTGGGAGAGTGTGGAGGGTGG + Intronic
1145978498 17:28997952-28997974 GCCTGGGGGTGGGGGCAGGGAGG - Intronic
1146160966 17:30559405-30559427 TCCTGGGCCAGGGTGCCGGGAGG - Exonic
1146357986 17:32151013-32151035 ACCTGGGAGTGGGGGAAGAGGGG + Intronic
1146408980 17:32565795-32565817 ACCTGGGAGGGGTTGCAGTGAGG - Intronic
1146688501 17:34857187-34857209 AGGTGGGAGAGGATGCAGGGTGG + Intergenic
1146889292 17:36495452-36495474 GTCTGGGAGAGGGAGCAGGCAGG - Exonic
1146903036 17:36600629-36600651 AAGGGGGAGAGGGTGCAGTGGGG - Exonic
1147235883 17:39057164-39057186 GCCTGGGCCAGGGTGGAGGGAGG + Intergenic
1147605626 17:41772292-41772314 CCCTGGGAAAGGCTGCAGGGAGG + Intronic
1147743513 17:42681779-42681801 AGGTGGGAGTGGGGGCAGGGAGG - Exonic
1148127367 17:45243770-45243792 ACCTGTGAGAGGGAGGAGAGGGG - Exonic
1148142511 17:45338607-45338629 ACCTGGGACAGGGTGTGGGGTGG + Intergenic
1148155769 17:45424654-45424676 ACTTGGGAGTGGGGGAAGGGTGG + Intronic
1148179590 17:45594571-45594593 ACCCGGCAGAGGTTGCAGTGAGG + Intergenic
1148554889 17:48572578-48572600 ACCTGGGAGTGGTTGCGGGGAGG + Intronic
1148600452 17:48890315-48890337 ACTTGGGAGAGTGAGGAGGGAGG + Intergenic
1148732667 17:49846998-49847020 ACCTGGAAGTGTGTGCAGTGAGG - Intronic
1148794387 17:50190107-50190129 CCCTGGGGGAGGAAGCAGGGCGG + Exonic
1148812113 17:50300021-50300043 TACTGGGTGAGGGTGGAGGGAGG - Intergenic
1149564055 17:57629057-57629079 ACTAGGGAGATGGTGGAGGGTGG - Intronic
1149637225 17:58180755-58180777 GCCTGCCACAGGGTGCAGGGAGG - Intergenic
1149686812 17:58540498-58540520 ACCTGGTAGAGGGGGCAAGTGGG - Intronic
1150004695 17:61462533-61462555 CATAGGGAGAGGGTGCAGGGAGG + Intronic
1150123619 17:62622537-62622559 GGCTTGGAGAAGGTGCAGGGTGG + Intergenic
1150209938 17:63436378-63436400 AGCTGGGGGAGGTTGGAGGGTGG - Intronic
1150387459 17:64773321-64773343 ACTTGGGAGTGGGGGAAGGGTGG + Intergenic
1150621918 17:66814161-66814183 TCCTGGGGGAGGAGGCAGGGAGG + Intergenic
1150646714 17:66983238-66983260 ACCTGGGTGCAGGTGCTGGGGGG - Intronic
1151187610 17:72375384-72375406 ACCTGAGAGATGGGGCAAGGAGG - Intergenic
1151207248 17:72516885-72516907 GCCGGGCAGCGGGTGCAGGGTGG + Intergenic
1151287009 17:73119480-73119502 AACTGGGGGTGGGAGCAGGGAGG - Intergenic
1151316437 17:73325364-73325386 GGCTGGGGGAGGGAGCAGGGAGG + Intergenic
1151344443 17:73492985-73493007 ACCTGGGAGGGGGTGGAAAGCGG + Intronic
1151402318 17:73863897-73863919 ACCTGGCTGGGGGTGCAGGAGGG - Intergenic
1151468764 17:74304843-74304865 CCCAGGGAGGGGATGCAGGGTGG - Intronic
1151512623 17:74570610-74570632 TCCTGGGAGAGTGAGAAGGGAGG - Intergenic
1151585108 17:75004082-75004104 CCCTGGGGGAGGCTGCAGGCCGG - Exonic
1151837169 17:76589534-76589556 ACCTTGCAGAGGGGGCAGGGAGG - Intergenic
1151956700 17:77383695-77383717 GCGTGGGAGAGGGTGCACGGAGG + Intronic
1152120719 17:78416677-78416699 GCCTGTGGGAGGGTGGAGGGTGG + Intronic
1152555505 17:81051079-81051101 GCCTGGGAGCCGGGGCAGGGAGG - Intronic
1152854158 17:82654371-82654393 ACCTAGAAGAGGGTGAAGGCTGG + Intergenic
1152920611 17:83064719-83064741 ACCAGGTACAGGGTGCAGGTGGG + Intergenic
1153078416 18:1192590-1192612 ACCTATCAGAGGGTGAAGGGTGG + Intergenic
1153262526 18:3238368-3238390 ACCTGGGGGAGGGGGGAGGCAGG + Intergenic
1153631341 18:7073096-7073118 AGCTGGGAGAGGGAGCAGGAAGG - Intronic
1153805270 18:8705195-8705217 GCCTGGGCGAGGGCGCTGGGCGG + Intergenic
1154507894 18:15060731-15060753 TCCTGAGCGAGAGTGCAGGGAGG - Intergenic
1155105736 18:22664097-22664119 GCCTGTTAGAGGGTGGAGGGTGG - Intergenic
1155709093 18:28853527-28853549 GCCTTGGAGAGTGTGGAGGGTGG + Intergenic
1156300669 18:35833453-35833475 ATCTGGGACTGGGTCCAGGGTGG - Intergenic
1157099980 18:44720642-44720664 ACATGTGAGAGAGTACAGGGAGG + Intronic
1157205168 18:45691853-45691875 ACCTGTGGCAGGGTGCAGGTGGG - Intergenic
1157698427 18:49743743-49743765 ACCTGTGAAAGGGGTCAGGGTGG + Intergenic
1157845365 18:50999506-50999528 ACCTGAGAGAGGGGGTGGGGTGG - Intronic
1158318836 18:56241357-56241379 CCCTGGGATGGGGTGCAGTGGGG + Intergenic
1158358746 18:56648877-56648899 TTCTGGGAGAGGGTCCAGGAAGG + Intronic
1158613909 18:58968535-58968557 ACAAGGGAGAAGGTTCAGGGAGG - Intronic
1159798084 18:72867718-72867740 GCCGGGGAGAGGGCGCAGCGAGG + Exonic
1160081746 18:75734408-75734430 GCCTACCAGAGGGTGCAGGGTGG - Intergenic
1160411439 18:78677877-78677899 ACCTGGGGGAGGGTCCCGAGAGG - Intergenic
1160411469 18:78677973-78677995 ACCTGGGGGAGGGTCCCGAGAGG - Intergenic
1160540094 18:79616694-79616716 AGCTCGGAGTGGGCGCAGGGCGG - Intergenic
1160777136 19:861531-861553 CCCTGGGTGGGGGTGCAGGTGGG - Intronic
1160807265 19:997614-997636 ACCTGGGCTGGAGTGCAGGGGGG - Intronic
1161180507 19:2877981-2878003 ACCTGTGAGTGGGGGCAGCGTGG + Exonic
1161301384 19:3544579-3544601 AGCTGGGTGAGGATGGAGGGTGG + Exonic
1161375265 19:3936692-3936714 AGCTGAGAGGGGATGCAGGGTGG + Intronic
1161427102 19:4209740-4209762 AACTGGGAGAGGGGCCAGCGCGG - Intronic
1161532812 19:4800374-4800396 ACCTGGGAGATGGGGAAGTGGGG + Exonic
1161846521 19:6714289-6714311 TCCCCGGAGAGGGAGCAGGGGGG - Intronic
1161851350 19:6739590-6739612 GCGTGGCAGAGCGTGCAGGGGGG + Intronic
1162022751 19:7875080-7875102 AGCTGGGAGGGTGTGGAGGGTGG - Intergenic
1162084610 19:8240961-8240983 AGCTGGGAGTGGGGCCAGGGAGG + Intronic
1162322796 19:9979742-9979764 ACCTGGGCTAGAGTGCAGTGGGG - Intronic
1162955076 19:14092882-14092904 AAGTGGGAGAGGGGGCAGGAGGG + Exonic
1163147167 19:15387955-15387977 GTCTGGGAGAGGGGGCGGGGAGG + Intronic
1163437204 19:17302898-17302920 ACCTGGGGTAGGGGGCAGGCAGG - Intronic
1163627269 19:18397357-18397379 TCCTGGGATAGGGTGGAGTGGGG + Exonic
1163846867 19:19643113-19643135 CCTTAGGAGAGGGGGCAGGGGGG - Intronic
1163898767 19:20082222-20082244 ACCTAGTAGAGGGTGGAGAGTGG - Intronic
1164095323 19:22004751-22004773 GCCTAGTAGAGGGTGGAGGGTGG + Intronic
1165246477 19:34500915-34500937 CCCTGGAAGAGGGAGCAGGGCGG - Exonic
1165866974 19:38945410-38945432 GCCTGGGGGAGGGTCCTGGGTGG + Intronic
1166270200 19:41708810-41708832 ACCTGGGAGAGGGTGGGAGGAGG + Intronic
1166499658 19:43331308-43331330 CCCTGGGAGAGGGTGGGAGGAGG - Intergenic
1166645688 19:44530033-44530055 TCTTGGGAGAAGGGGCAGGGAGG + Intergenic
1167102936 19:47415139-47415161 AATTGGGGGAGGGAGCAGGGAGG + Intronic
1167220248 19:48194632-48194654 ACCTGCGGGCGGGGGCAGGGAGG - Exonic
1168084143 19:54032971-54032993 GCCTGTCAGAGGGTGGAGGGTGG - Intergenic
1168277182 19:55284600-55284622 ACCTGGGGCGGGGGGCAGGGTGG + Intronic
1168290597 19:55355205-55355227 ACCTGGGGGCGGGGGGAGGGGGG - Intronic
1168316210 19:55485804-55485826 GCCTGGGAGTGGCTGCAGTGGGG + Intronic
1168685641 19:58347626-58347648 GCCTGGGAGGGGGTCCTGGGCGG + Exonic
925126820 2:1463130-1463152 ACGTGGGAGAGGCCCCAGGGTGG + Intronic
925187560 2:1859768-1859790 ACCAGGGCCAGGGGGCAGGGCGG - Intronic
925277958 2:2663711-2663733 CTCTGGGAGAGGGTGCACGGTGG - Intergenic
925324753 2:3009321-3009343 GCTTGTGAGAGGGTGCAGTGAGG + Intergenic
925493100 2:4417855-4417877 AGCTGAGAGAAGGGGCAGGGAGG - Intergenic
925719763 2:6815763-6815785 ACCTGTCAGAGGGTGGAGGGTGG + Intergenic
925767404 2:7249825-7249847 ATCTGGGAGATGGTACAGTGAGG - Intergenic
926469224 2:13232337-13232359 ACCTACCAGAGGGTGGAGGGTGG + Intergenic
926733032 2:16051471-16051493 ACCAGGCAGAGGGTGGAGGCAGG + Intergenic
927319264 2:21723408-21723430 AAGTGGAAGAGGGGGCAGGGAGG + Intergenic
927787596 2:25984228-25984250 ATCAAGGAGAGGGTGGAGGGAGG - Intergenic
927846083 2:26473566-26473588 ACCTGGGAGAGGTTGGAGGGTGG + Exonic
928244390 2:29614695-29614717 ACCTGGGGGATGGTGAAGGATGG - Intronic
928395457 2:30940168-30940190 AAGTTGGAGAGGGTGCTGGGAGG - Intronic
928705226 2:33942110-33942132 GCCTGTCAGAGGGTGGAGGGTGG + Intergenic
929928288 2:46232914-46232936 ACCTGGCTGTGGGGGCAGGGTGG + Intergenic
932375504 2:71232095-71232117 ACTTGGGAGACTGTGGAGGGAGG - Intergenic
932398991 2:71466669-71466691 GCCTGGGAGAGGCTGCAGGGAGG - Intronic
932402555 2:71491565-71491587 ACCTTTCAGAGGGTGGAGGGTGG - Intronic
932446536 2:71785294-71785316 ACCTGCTTGATGGTGCAGGGTGG + Intergenic
932598129 2:73106906-73106928 ACCTCCGAGAAGCTGCAGGGTGG - Intronic
933279713 2:80319695-80319717 ACCTGGGATGGGGTGCTAGGTGG - Intronic
933939910 2:87236449-87236471 ACCTGGAACAGGGGGCTGGGAGG - Intergenic
934319599 2:91960469-91960491 GGCTGTGAGAGGGTGCAGAGAGG + Intergenic
934907355 2:98216984-98217006 ACCTGAGACTGGGTGCGGGGCGG - Intronic
935756739 2:106282284-106282306 ACATGGGAGAGGGTTCACAGGGG - Intergenic
937168133 2:119840261-119840283 ACCTGTGAGAGGGTGGGAGGTGG - Intronic
937248745 2:120510467-120510489 ACCTGGGCCAGGGTCCTGGGGGG + Intergenic
937345153 2:121120953-121120975 AACTGGGGGAGGGAGCATGGTGG - Intergenic
937468396 2:122154780-122154802 GCCTGGGAGACAGTGCTGGGAGG + Intergenic
937677272 2:124605737-124605759 ACCTGGCGGAGGTTGCAGTGAGG + Intronic
937911027 2:127075756-127075778 TTCTGGGAGAGGGTGGTGGGGGG - Intronic
938125725 2:128669946-128669968 CCATGGGAGTGGCTGCAGGGAGG + Intergenic
939153073 2:138495571-138495593 CCCTGGGAGATGGTGCAGTCTGG + Intergenic
940374185 2:152938850-152938872 TCATGGGAGAGGGTGAAGGAGGG - Intergenic
941371989 2:164677026-164677048 ACCTGTGAGAGGGAGAAAGGGGG - Intronic
941390029 2:164900763-164900785 AGTGGGGAGGGGGTGCAGGGCGG - Intronic
942231038 2:173861009-173861031 GGCTGGGAGAAGGAGCAGGGAGG + Intergenic
942303729 2:174586499-174586521 AGGTGGGTGAGGGGGCAGGGCGG + Intronic
943624623 2:190184702-190184724 ACAGGGGAAAGGGTGCTGGGTGG + Intronic
944102568 2:196044437-196044459 AAGGGGGAAAGGGTGCAGGGGGG + Intronic
945177407 2:207056568-207056590 ACCTATTAGAGGGTGGAGGGTGG + Intergenic
945290359 2:208120672-208120694 ACCTGTTGGAGGGTGGAGGGTGG - Intergenic
945374014 2:209057858-209057880 TACTGGGAGAAGGTGCTGGGAGG + Intergenic
945438552 2:209849646-209849668 ACTTGGGATGGGGGGCAGGGTGG - Intronic
946202828 2:218080824-218080846 ACCTGGGTGAAGGTGTAGGGAGG + Intronic
946401265 2:219469486-219469508 ACCAGGGACAGGGTGCCTGGGGG + Intronic
948478435 2:238236069-238236091 GCCTGGGCCAGGGTGCAGGCAGG + Intergenic
948483491 2:238264979-238265001 AGCTGGGAGAAGATGCATGGTGG + Intronic
948519891 2:238529345-238529367 ACCTGGGAAAGGGAGGAGTGTGG + Intergenic
948528273 2:238586930-238586952 ACCTGGGAGAGAGAGCAGGGAGG + Intergenic
948655684 2:239475570-239475592 ACCTGTGTGAGGGCCCAGGGCGG + Intergenic
948699443 2:239750943-239750965 TCCTGGGAGAGGCTGCTGGGGGG + Intergenic
948788083 2:240363430-240363452 GCCTGGGAGAAGGTGGGGGGTGG - Intergenic
948796141 2:240402869-240402891 TCCTGGGAGCGGGGGCAGGAGGG - Intergenic
948880100 2:240852315-240852337 GCCAGGGGGAGGTTGCAGGGTGG - Intergenic
948881772 2:240861811-240861833 ATCTGGGAGAAGCTGCAGTGTGG - Intergenic
948901471 2:240958736-240958758 ACCTGGGCAGGGGTGCAGTGGGG + Intronic
948927801 2:241110647-241110669 AGCTTGGGGAGGGTGCAGGGGGG - Intronic
948982473 2:241501382-241501404 ACATGCCAGAGGGTGCAAGGCGG - Intronic
1168959120 20:1856527-1856549 ACATGAGAGAGGGCACAGGGTGG - Intergenic
1169001639 20:2172225-2172247 TCCAGGCAGAGGGAGCAGGGAGG - Intronic
1169316149 20:4592579-4592601 ACCTGGGAAAGGGGGCAGAAAGG + Intergenic
1169378387 20:5085847-5085869 CCTTGGGAGAGGATGCAGGCAGG - Intronic
1169676743 20:8163238-8163260 CCCTGGGAGACAGTGCAGAGAGG + Intronic
1169714641 20:8601372-8601394 ACCTATCAGAGGGTGCAGGGTGG - Intronic
1171046006 20:21809798-21809820 ACGTGGGCGAGGGAGCAGGCTGG + Intergenic
1172178492 20:32986698-32986720 AGCTGGGAGAGGGCCCAGGAGGG + Intronic
1172391405 20:34567829-34567851 ACCTGGGTGGGGGTGAAGGAGGG - Intronic
1172600218 20:36178059-36178081 ACCTGGGCTAGGGAGCAGGGTGG + Intronic
1173018559 20:39248269-39248291 CCCTGGGAGAGGGGCCTGGGGGG + Intergenic
1173053493 20:39588568-39588590 AACAGGGAGAGGGTGCTGGGAGG + Intergenic
1173189104 20:40862735-40862757 GCCTGAGGGTGGGTGCAGGGAGG + Intergenic
1173252237 20:41370139-41370161 ACCTGGGAAAGGGGGAAGTGGGG - Intergenic
1173328427 20:42054264-42054286 ACTGGGGTGAGGGTGGAGGGAGG + Intergenic
1173560595 20:44002714-44002736 TCCTGGGAGAAGGTGAAGGGGGG + Intronic
1173653406 20:44682334-44682356 AGCTGGTAGCAGGTGCAGGGAGG - Intergenic
1173754152 20:45500190-45500212 GCTTGGGAAAGGGTGCAGGAAGG - Intergenic
1174206447 20:48843521-48843543 ACCTGGCAGAGTGTTCAGGAGGG - Intergenic
1174308449 20:49631810-49631832 ACCTGGCAGAGACAGCAGGGTGG - Intergenic
1174407472 20:50311534-50311556 GCCTGAGGGAGGGTGCAGAGGGG - Intergenic
1174771044 20:53300798-53300820 ACTTTGGAGAGGAAGCAGGGAGG + Intronic
1174805187 20:53598966-53598988 CCCTGGGAGGGGGAGGAGGGGGG + Intronic
1175028135 20:55924863-55924885 TCCTGGGAGTGGGCACAGGGTGG - Intergenic
1175145873 20:56895820-56895842 ATCTGAGAGAGAGAGCAGGGCGG - Intergenic
1175167577 20:57055772-57055794 ACCTGGGAGAGGGAACATGAAGG + Intergenic
1175260509 20:57670955-57670977 ACCTGGAGGAGGATGCAGCGCGG + Intronic
1175457723 20:59127864-59127886 ACTTTGGAGAGGATGCAGAGTGG + Intergenic
1175825406 20:61934035-61934057 TCCTGGGGGAGGGAGCCGGGAGG - Exonic
1175831538 20:61967551-61967573 AGGTGGGAAGGGGTGCAGGGAGG - Intronic
1175851947 20:62098323-62098345 ACCTGGGAGGAGGTGCAGGCCGG - Intergenic
1175900440 20:62357902-62357924 ACCTGGGCTGGGCTGCAGGGAGG - Intronic
1175925925 20:62471292-62471314 GCATGGGTGAGGGTGAAGGGAGG + Intronic
1176024675 20:62979699-62979721 TCCTGGCAGAGGGGGCAGAGAGG - Intergenic
1176790188 21:13311068-13311090 TCCTGAGCGAGAGTGCAGGGAGG + Intergenic
1177156732 21:17508384-17508406 ACCTGGGAGGCGGTGGTGGGTGG - Intergenic
1177348129 21:19900116-19900138 GCTGGGGGGAGGGTGCAGGGAGG - Intergenic
1177811286 21:25927270-25927292 ACTTGGGAGAGTGTTCTGGGAGG - Intronic
1177989366 21:28019277-28019299 TCCTGAGCGAGAGTGCAGGGAGG + Intergenic
1178244029 21:30935292-30935314 ACCTGGGAGCTGCTGCAGTGGGG + Intergenic
1179525062 21:41970790-41970812 ACCTGGCAGAAGGAGCAGTGGGG + Intergenic
1179982963 21:44905972-44905994 CCCAGGGAGAGGGTGCAGACGGG - Intronic
1180168014 21:46040117-46040139 TCCTGGGAGAGGCTGGAGGGAGG - Intergenic
1180938583 22:19641963-19641985 AGGTGGGGGAGGGGGCAGGGGGG + Intergenic
1180968302 22:19801864-19801886 ACTTGGAGGCGGGTGCAGGGGGG - Intronic
1182256160 22:29040166-29040188 AAGGGGGAGGGGGTGCAGGGAGG - Intronic
1182425087 22:30267441-30267463 GCCTGGCAGAGGGTGCACGATGG - Intergenic
1182573897 22:31259867-31259889 ACTGGGGAGAGGGCACAGGGGGG - Exonic
1182591142 22:31381112-31381134 ACCTACTTGAGGGTGCAGGGCGG - Intergenic
1182723183 22:32421083-32421105 AGCTGGGAGAGGGGTCAGGGAGG - Intronic
1183118760 22:35713390-35713412 CCCAGAGAGAGGGTGCAGGGAGG - Intergenic
1184035463 22:41915749-41915771 ACCTGCGGGTGGGCGCAGGGCGG - Intergenic
1184117697 22:42431777-42431799 AGCGGGGAGAGGGGGGAGGGGGG - Intronic
1184121200 22:42451675-42451697 ACCTAGAAGAGGGAGGAGGGAGG - Intergenic
1184277917 22:43420822-43420844 ACATGGGACGGGGTGGAGGGGGG - Intronic
1184290926 22:43497792-43497814 ACCTGGGGGAGGGAGGATGGAGG + Intronic
1184562617 22:45272168-45272190 AGCTGGGAGAGGCAGCAGAGAGG + Intergenic
1184672982 22:46025322-46025344 ACCAGGGAGAGGGAGCAAGAGGG - Intergenic
1184703498 22:46194071-46194093 TGCTGGGAGGGCGTGCAGGGTGG + Intronic
1184728852 22:46362224-46362246 ACCTGGGAGGCGGTGAGGGGAGG + Exonic
1184778702 22:46635645-46635667 GGCTGGGAGTGGGGGCAGGGAGG - Intronic
1185069379 22:48647818-48647840 GCCCAGGAGAGAGTGCAGGGAGG + Intronic
1185082935 22:48719578-48719600 CCTTGGGAGAGAATGCAGGGGGG - Intronic
1185106285 22:48871716-48871738 AGCTGGGAGGGGCAGCAGGGTGG - Intergenic
1185163688 22:49244714-49244736 ACCTGGCGAAGGGTGCAGAGAGG - Intergenic
1185332255 22:50257052-50257074 CCCCGGGGGAGGCTGCAGGGAGG - Intronic
949966770 3:9363259-9363281 GCCTGGGAGAGGGAGCAAGATGG - Exonic
950082640 3:10234559-10234581 ACCTGGAGAAGGGCGCAGGGAGG + Exonic
950475361 3:13211426-13211448 ACCTGGGGCAGGGGGCAGAGGGG - Intergenic
950563339 3:13748831-13748853 GCCTGGGCCGGGGTGCAGGGAGG + Intergenic
951274125 3:20664196-20664218 GCCTGCTAGAGGGTGGAGGGTGG - Intergenic
952065155 3:29560889-29560911 ACCTTTCAGAGGGTGGAGGGTGG - Intronic
952880219 3:37980721-37980743 ACCTGGAAGACAGTGCATGGAGG - Exonic
952901077 3:38112092-38112114 ACCAAGGAGAGGCTGGAGGGTGG + Intronic
953407161 3:42665169-42665191 ACCTGGGTGAGCGTGGGGGGTGG + Exonic
953463917 3:43103417-43103439 TGCTGGGTGAGGGTGCAGGCTGG - Intronic
953534678 3:43768726-43768748 AGCTTGGAGAGGCTGAAGGGAGG + Intergenic
953574788 3:44104363-44104385 CCCAGGGAGAGGGTGGAGAGGGG - Intergenic
953664958 3:44918759-44918781 GCTTGGAAGAGGCTGCAGGGTGG - Intronic
953876278 3:46668526-46668548 ACCTGGGACAGAGTGGAGAGAGG - Intergenic
954326935 3:49869060-49869082 ACTTGGGAAAGGGGTCAGGGTGG - Intronic
954697291 3:52434707-52434729 AGCTGGGGAAGGGTGCAGGCGGG - Exonic
955687654 3:61562470-61562492 ACCCTGGAGAGGGTGGAGGGTGG + Intronic
956619564 3:71207620-71207642 ACCAGGGTGAGGGTGGAGGCTGG - Intronic
956910399 3:73810156-73810178 ACCTGCCAGAGGGTGGCGGGTGG + Intergenic
957171140 3:76738023-76738045 ACCTGGGAGACTGTGGTGGGAGG + Intronic
958435187 3:94087777-94087799 ACCTGGGAGACCGAGGAGGGAGG - Intronic
958606025 3:96359736-96359758 ACCTGCCAGAGGGTGGAAGGTGG + Intergenic
959315959 3:104807131-104807153 ACTTGGGGGTGGGTGGAGGGGGG - Intergenic
960699453 3:120426337-120426359 AGCTGGGGGTGGGTGGAGGGTGG - Intronic
961172570 3:124808446-124808468 ACTTGCGTGAGGGAGCAGGGAGG - Intronic
961300838 3:125921053-125921075 CCATGGGAGACAGTGCAGGGCGG + Intergenic
961446990 3:126985521-126985543 GCCTGGGAGCTGGTGCAGGAGGG - Intergenic
961554711 3:127690074-127690096 ATCTGGGGGAGGCAGCAGGGAGG + Exonic
961563698 3:127748367-127748389 AGGTGGGAGAGGGAGGAGGGAGG + Intronic
961788098 3:129359432-129359454 ACCTGGGGCAGGGGGCAGAGGGG + Intergenic
962171216 3:133103425-133103447 ACCTTTCAGAGGGTGGAGGGTGG + Intronic
962707650 3:138061155-138061177 AGCTGGGGGAGGGGGCAGGCTGG - Intergenic
962777169 3:138672666-138672688 ACCTGGGAGATGGAGCCAGGCGG + Intronic
962827137 3:139108237-139108259 ACCTGGCAGAGAGAGCAGGCTGG - Intronic
963204459 3:142618267-142618289 ACTTGGGAGATGCAGCAGGGTGG - Intronic
964359719 3:155881957-155881979 ACCTGGGAGACTGAGCTGGGAGG + Intronic
964569346 3:158095068-158095090 ACCTGGGAGAGGGCCAAGTGGGG + Intergenic
965360547 3:167734506-167734528 CCCCGGGAGAGGGGACAGGGCGG - Intronic
965590814 3:170358264-170358286 CCCAGGGAGAGGGTGCGCGGGGG + Intronic
965813657 3:172615374-172615396 ACTATGGGGAGGGTGCAGGGAGG - Intergenic
966516092 3:180822136-180822158 CCCTGGGAGTTGGTGGAGGGTGG + Intronic
966910363 3:184556203-184556225 CTCTGGGAGAGGGGTCAGGGAGG - Intronic
966928153 3:184658884-184658906 GCCTGGGAGAGGGAGGAGGGGGG - Intronic
966975230 3:185077114-185077136 ACATGGTATAGGGTGCGGGGTGG + Intergenic
967429368 3:189363898-189363920 ACTTGGGAGAGGTTGGGGGGGGG - Intergenic
967954377 3:194867092-194867114 AACTGGAACAGGGTACAGGGAGG + Intergenic
968033813 3:195527756-195527778 ACCTGGGAGGCGGAGGAGGGAGG + Intronic
968228916 3:196992840-196992862 GGCTGGGAGGGGATGCAGGGAGG - Intronic
968573241 4:1353443-1353465 ACCCGGGAGCCGGGGCAGGGTGG - Intronic
968603495 4:1520973-1520995 ACCTGGGCGGGGCTGGAGGGGGG - Intergenic
968964950 4:3765116-3765138 ACGGGGGCGAGGGTGCACGGGGG + Intergenic
968996803 4:3950969-3950991 CCATGGGAGACAGTGCAGGGCGG - Intergenic
969246193 4:5934533-5934555 GCCGGGAGGAGGGTGCAGGGAGG - Intronic
969757205 4:9157707-9157729 CCATGGGAGACAGTGCAGGGCGG + Intergenic
971241618 4:24894363-24894385 AACTGAGAGAGGGTGAAGAGAGG + Intronic
971473900 4:27054788-27054810 GCCTTGGAGTGGGGGCAGGGCGG - Intergenic
974099309 4:57399195-57399217 ATCTGGGTGAGGGTGAAGAGGGG + Intergenic
975494375 4:75021611-75021633 ACCTAGTTGAGGGTGGAGGGTGG - Intronic
975664853 4:76725628-76725650 ACCTGGAAGAGGGAGAAGTGAGG - Intronic
976765150 4:88591854-88591876 GCCTGGGGGAGGCTGGAGGGTGG - Intronic
977566218 4:98583410-98583432 GCCTGGTGGAGGGTGGAGGGTGG - Intronic
978083221 4:104620046-104620068 AACTGGGGGTGGGAGCAGGGTGG + Intergenic
979301119 4:119088471-119088493 ACCTGTCAGAGGGTGATGGGAGG - Intergenic
979945422 4:126825473-126825495 TCCTGTCAGAGGGTGGAGGGTGG + Intergenic
979993522 4:127404198-127404220 ACCTAGGACAGGGTGTAGGAGGG + Intergenic
980748914 4:137062517-137062539 GCCTTTCAGAGGGTGCAGGGTGG - Intergenic
981008215 4:139897382-139897404 TCCTGGATGAGGGTGCAGTGTGG - Intronic
981691094 4:147509925-147509947 ACCTGGCAGCGGGGGCAGGATGG - Intronic
982044947 4:151435268-151435290 GGCTGAGAGAGGGTGGAGGGAGG - Intronic
982351195 4:154416977-154416999 AGCTGGGAGAGGGTAATGGGAGG - Intronic
983029602 4:162783253-162783275 ACCTGGGGGAGAGAGCAGGTTGG + Intergenic
983347835 4:166549182-166549204 AGCTGGAAGAGGGTATAGGGAGG - Intergenic
983413325 4:167424877-167424899 TGCTGGGGGAGGGTGCAGGTGGG - Intergenic
985788381 5:1911741-1911763 GCCTGGGAGAGGGGACAGGAAGG + Intergenic
985822622 5:2170351-2170373 ACCATGGAGAGCCTGCAGGGAGG - Intergenic
985888084 5:2695654-2695676 ACCGGGGAAAGGCTGGAGGGAGG - Intergenic
986172645 5:5326686-5326708 ACCAGGGAGAGGGCACAGGGTGG - Intergenic
986409006 5:7457619-7457641 AAATGGGACAAGGTGCAGGGAGG + Intronic
987305293 5:16631973-16631995 AGCTGGGAGAGGCTACATGGGGG - Intergenic
987484313 5:18504286-18504308 CCCTGAGAGAGGATTCAGGGAGG - Intergenic
987511061 5:18839504-18839526 CCCTGTGAGAGGGTGCTGGATGG - Intergenic
988894857 5:35661575-35661597 ACCTTTCAGAGGGTGGAGGGTGG - Intronic
990757384 5:59088778-59088800 ACCTATCAGAGGGTGGAGGGTGG + Intronic
990885052 5:60581794-60581816 ACCTAGTTGAGGGTGGAGGGTGG - Intergenic
990977250 5:61570752-61570774 ACCATGGAAAGGGGGCAGGGTGG + Intergenic
991113450 5:62927313-62927335 ACCTAGGAGAGGGAAGAGGGTGG + Intergenic
991251185 5:64563036-64563058 TCCAGGGAGAGGGTGCAAGCAGG - Intronic
992093328 5:73338847-73338869 AGCGGGGAGAGGGAGGAGGGTGG + Intergenic
992259050 5:74951953-74951975 ACTTGGGAGATTGTTCAGGGTGG + Intergenic
992504071 5:77368225-77368247 ATCTGGAAGGGGGTGCAGGATGG - Intronic
993556716 5:89348549-89348571 ACCTATCAGAGGGTGGAGGGTGG + Intergenic
994083682 5:95735197-95735219 ACTTGGTAGAGGGTGCAAGGGGG - Intronic
994359184 5:98830959-98830981 GCCTAGCAGAGGGTGGAGGGTGG + Intergenic
994429016 5:99632008-99632030 GCCTGTCAGAGGGTGGAGGGTGG - Intergenic
995447817 5:112265908-112265930 GCTTGGGAGAGGGTGTGGGGAGG + Intronic
995860371 5:116634533-116634555 CCCTGGGATAGGGGGCAGGAGGG + Intergenic
996548564 5:124706909-124706931 GCATGGGAGGGGGAGCAGGGAGG + Intronic
997228596 5:132227602-132227624 ACAGGGCGGAGGGTGCAGGGTGG + Intronic
997292883 5:132750004-132750026 AACTGGGAGAAGTTGGAGGGAGG - Intronic
997523406 5:134537641-134537663 ACCTGGGGCAGGGTGGAGTGTGG + Intronic
997615918 5:135246140-135246162 CTCTGGGAGAGTGAGCAGGGAGG + Intronic
998160312 5:139809370-139809392 ACCTGGCAGTGGGTGGAGAGAGG - Exonic
998165409 5:139839832-139839854 ACCTGGGGGAGGAGGAAGGGAGG + Intronic
998171879 5:139877389-139877411 AGCTAGAAGAGGGTACAGGGAGG - Intronic
998369004 5:141649422-141649444 ACCTAGCAGGGGGTACAGGGCGG - Exonic
998384716 5:141750141-141750163 AACAGGGAGATGGTGGAGGGAGG + Intergenic
999812067 5:155137183-155137205 GCCTGTCAGAGGGTGGAGGGTGG - Intergenic
999892705 5:155996278-155996300 GCCTGGGTGAGGGTGAAGGATGG - Intronic
1000249742 5:159482617-159482639 ACATGGCAGAGGGTAAAGGGGGG + Intergenic
1000806713 5:165804147-165804169 ACCAGGGACAGGGTGGGGGGTGG + Intergenic
1001971396 5:175957548-175957570 TCCTGGGAGAGGGTCCTGTGTGG - Intronic
1002103371 5:176868291-176868313 CCCTGGGGGAGGGCGCACGGCGG + Intronic
1002134792 5:177100883-177100905 GGCAGGGAGGGGGTGCAGGGTGG - Intergenic
1002201800 5:177532886-177532908 ACCTGAGAAGGGGTGCATGGTGG - Intronic
1002246046 5:177886229-177886251 TCCTGGGAGAGGGTCCTGTGTGG + Intergenic
1002304185 5:178273767-178273789 ACCTTGGAGAAGCTGCTGGGTGG + Intronic
1002364105 5:178696789-178696811 ACTGGGGAGAGGGTGGAGAGAGG + Intergenic
1002444743 5:179282969-179282991 CCCTGGGAGAGGGTGCACAGAGG + Intronic
1002860488 6:1075425-1075447 ACCTGGGGTAGGAGGCAGGGAGG + Intergenic
1003110503 6:3248731-3248753 ACCTGGAAAGGGGTGCAGGGAGG + Intronic
1003165297 6:3672049-3672071 CCCTGGGTGAGGGTGGAGGGTGG + Intergenic
1003314899 6:5003571-5003593 AACTGGGAGTGAGTCCAGGGAGG - Intronic
1003396053 6:5752878-5752900 ACCTGGGAGAGAGACCTGGGGGG - Intronic
1004322680 6:14644915-14644937 AAAAGGGAGAGGGTGGAGGGAGG + Intergenic
1004626251 6:17380022-17380044 ACCTGGGAGGCGGTGGTGGGAGG - Intergenic
1004968916 6:20886722-20886744 ACCAGGGAAAGGGTGAAGGGAGG + Intronic
1005045259 6:21635830-21635852 ACCTGGGAGACTGAGCTGGGGGG + Intergenic
1005267870 6:24131983-24132005 CCCAGGGAAAGAGTGCAGGGAGG - Intronic
1006203743 6:32320835-32320857 GCCTGTCAGAGGGTGGAGGGTGG - Intronic
1006447985 6:34090644-34090666 ACCTGGTGGAGGGGGCAGCGGGG - Intronic
1006641751 6:35492856-35492878 CCCAGGGAGGGGGTGAAGGGAGG - Intronic
1006813589 6:36836625-36836647 CCCTGAGAGCGGGTGCAGTGGGG + Intronic
1007060755 6:38938582-38938604 ACCTGTCAGAGAGTGGAGGGTGG + Intronic
1007360638 6:41353010-41353032 TCCTCAGAGAGGGTGCTGGGAGG - Intergenic
1007823852 6:44583253-44583275 ACATGGGAGAGAGAACAGGGAGG - Intergenic
1008332393 6:50260325-50260347 GCCTGGGGTAGGGTGCAGTGAGG + Intergenic
1008365591 6:50675485-50675507 ACTTGGGAGACGGGGGAGGGAGG + Intergenic
1008712875 6:54249948-54249970 GCCTGTCAGAGGGTGGAGGGTGG - Intronic
1008802994 6:55392716-55392738 GCCTGCTAGAGGGTGGAGGGTGG + Intronic
1009039418 6:58158754-58158776 ACCTGGGAATGGGTGAGGGGTGG + Intergenic
1009215312 6:60913597-60913619 ACCTGGGAATGGGTGAGGGGTGG + Intergenic
1012171008 6:96016319-96016341 TCCAGGCAGAGGGTCCAGGGAGG + Intronic
1012432939 6:99185357-99185379 ACCTGAGAGATGGTAGAGGGAGG - Intergenic
1013329288 6:109082591-109082613 AGCAGGGAGAGGTTGCAGAGAGG - Intronic
1013579475 6:111518794-111518816 ACCTGGGGTAGGGTTGAGGGGGG - Intergenic
1013799545 6:113925991-113926013 ACATGTGAGAGGTTACAGGGGGG + Intergenic
1014089674 6:117389432-117389454 GCCTGGCAGAGGGTGCAGCTGGG + Exonic
1015047622 6:128795310-128795332 GCCTATGAGAGGGTGGAGGGTGG + Intergenic
1016075360 6:139788906-139788928 CTTTGGGAGAGGGTGCAGGTAGG + Intergenic
1016371178 6:143375740-143375762 ACCTGGGAGACTGAGCTGGGAGG + Intergenic
1016813995 6:148286967-148286989 CGCATGGAGAGGGTGCAGGGTGG - Intronic
1017044431 6:150334073-150334095 CCCAGGGAGAGTGTGCAGGGAGG - Intergenic
1017665914 6:156720104-156720126 CCCGGGGAGCGGGTGCGGGGCGG - Intergenic
1018247994 6:161840599-161840621 GCCTGGCAGAAGGTGGAGGGTGG - Intronic
1018706807 6:166469534-166469556 GCCGGGGAGTGGGTGCAGGGAGG + Intronic
1019040084 6:169096490-169096512 TCCTGGGTGAGGATCCAGGGTGG + Intergenic
1019054376 6:169213085-169213107 GCCCAGGAGAGGGCGCAGGGAGG + Intergenic
1019163199 6:170082511-170082533 CCCTGGGTGGGGGTTCAGGGAGG - Intergenic
1019163966 6:170087147-170087169 ACGTGGCCAAGGGTGCAGGGCGG + Intergenic
1019492685 7:1322574-1322596 ACCTGGGGGCAGGAGCAGGGGGG - Intergenic
1019518969 7:1452102-1452124 ACCTGGGAGGGGGTCCAAGCTGG - Intronic
1019540818 7:1550246-1550268 ACCTGGGACAGGGAGCCCGGCGG - Intronic
1019696790 7:2450788-2450810 GCCTGGGAGAGGGTGGGGGGCGG - Intergenic
1019765024 7:2843816-2843838 ACCTGGGTGCAGGTGCTGGGCGG + Intronic
1019768818 7:2870709-2870731 TACAGGGAGAGGATGCAGGGTGG + Intergenic
1019967279 7:4510037-4510059 ACCTATCAGAGGGTGAAGGGTGG + Intergenic
1020377723 7:7507025-7507047 AACTGGCAGAGGGTGCAAGTGGG + Intronic
1020868279 7:13592886-13592908 AGTTGGGAGAGGGGGCATGGGGG - Intergenic
1021566282 7:22019805-22019827 ACCTTTCAGAGGGTGGAGGGTGG + Intergenic
1021594398 7:22299772-22299794 AGGTGGGGGAGGGTGGAGGGGGG - Intronic
1021812739 7:24419160-24419182 ACCTGGGAGAGGGCGAAGGTGGG - Intergenic
1022360369 7:29650848-29650870 ACCTGCCAGGGGGTGCACGGAGG + Intergenic
1023842319 7:44104462-44104484 ACCCGGGAAGGGGTGCTGGGGGG - Exonic
1024655949 7:51451542-51451564 ACCTGGGAGAGCGTTCCAGGAGG - Intergenic
1025603923 7:63025192-63025214 ACTTGGGAGTGGGGGCAGGAGGG - Intergenic
1026045335 7:66902730-66902752 GCCTGGGGGAGGCTGCAGTGAGG - Intergenic
1026049048 7:66929742-66929764 ATTTGGCTGAGGGTGCAGGGAGG + Intronic
1026500734 7:70941399-70941421 GCCTGTGGGAGGGTGGAGGGTGG + Intergenic
1026546885 7:71330926-71330948 CCGTGGCAGAGGGTGCAGAGAGG - Intronic
1026606200 7:71818179-71818201 ACCTGGTTGGGGGTGAAGGGTGG + Intronic
1026664647 7:72331854-72331876 GCCTGTTAGAGGGTGGAGGGTGG - Intronic
1026956376 7:74378875-74378897 TCCTGGGAGAAGGGGCAGGAAGG - Intronic
1027571038 7:79867397-79867419 GCCTGTCAGAGGGTGGAGGGTGG + Intergenic
1027723244 7:81770622-81770644 ACCTGGGAGAGGTGGGAGCGGGG + Intergenic
1028889082 7:95966860-95966882 ACCTCATAGTGGGTGCAGGGAGG + Intronic
1028986790 7:97015757-97015779 AAGTGGGTGAGGGTGAAGGGTGG - Intergenic
1029274223 7:99394530-99394552 AGCGGGGAGAGGGGTCAGGGAGG + Exonic
1029452179 7:100647351-100647373 GCATGGGAGGGGGAGCAGGGAGG - Intronic
1029477011 7:100791208-100791230 TCCAGGGAGAGGGTGCAGATAGG + Intronic
1029788593 7:102818951-102818973 GCCTGTCAGAGGGTGGAGGGTGG - Intronic
1029964475 7:104724598-104724620 ACCTTTCAGAGGGTGGAGGGTGG + Intronic
1029978104 7:104852844-104852866 ACTGGGAAGAGGGTGGAGGGAGG - Intronic
1031406736 7:121395978-121396000 ACGTTGGAGAGGGCGCAGGCGGG - Intronic
1031692915 7:124812943-124812965 ACCTTGGAGCGGGTGGGGGGTGG - Intergenic
1031912781 7:127534956-127534978 ACGTGGGGGAGGGAGCAAGGAGG - Intergenic
1032451469 7:132035397-132035419 ACCTGGGAGTGGGTGCAGGACGG - Intergenic
1033168730 7:139064801-139064823 ACGTGGGAGTGGGAGCAGAGTGG - Intronic
1034174482 7:149090344-149090366 GCCTGGGCGAGGATGCCGGGCGG - Intronic
1034978651 7:155461949-155461971 GACTGGGAAAGGCTGCAGGGCGG - Intronic
1035230118 7:157460217-157460239 GCCTGGGACAGGCTTCAGGGAGG + Intergenic
1035252121 7:157604278-157604300 TCCTGGGAGAGGATGCGGGTGGG - Intronic
1035291329 7:157841067-157841089 TGCTGGGAGCGAGTGCAGGGCGG - Intronic
1036307663 8:7613694-7613716 AGGTGGGGGAGGGTGGAGGGGGG + Intergenic
1036307969 8:7615886-7615908 CCCTGGGGGAGGGTGCAATGAGG - Intergenic
1036358517 8:8061695-8061717 AGGTGGGGGAGGGTGGAGGGGGG + Intergenic
1036380438 8:8233022-8233044 CCATGGGAGACAGTGCAGGGTGG + Intergenic
1036435338 8:8728031-8728053 GCCTGGTTGAGGGTGGAGGGTGG + Intergenic
1036849127 8:12189638-12189660 CCATGGGAGACAGTGCAGGGTGG - Intronic
1036870488 8:12431912-12431934 CCATGGGAGACAGTGCAGGGTGG - Intronic
1037308472 8:17530174-17530196 ACCGGGGATGGGGGGCAGGGGGG - Intronic
1037429259 8:18792554-18792576 GCCTGTCAGAGGGTGGAGGGTGG + Intronic
1037548829 8:19950206-19950228 ACCTGGTATAGGCAGCAGGGAGG + Intronic
1037724062 8:21468529-21468551 ACTGGGGAGAGGGCACAGGGAGG - Intergenic
1038277523 8:26134335-26134357 AAAGAGGAGAGGGTGCAGGGAGG - Intergenic
1038516279 8:28190330-28190352 GCCTGGGAGAGGCTGCTGGCTGG - Exonic
1038525537 8:28269996-28270018 CCCTGTCAGAGGGTGGAGGGTGG + Intergenic
1039478532 8:37854846-37854868 ACCGGGGACTGGGAGCAGGGAGG + Intergenic
1040582490 8:48708841-48708863 GCCTGGGAGAGAGGGCAAGGAGG + Intergenic
1040926846 8:52693770-52693792 GCCTGTCAGAGGGTGAAGGGTGG + Intronic
1041250174 8:55926160-55926182 ACGTGGGAGAGGCTTCAGGAAGG - Intronic
1041465159 8:58151028-58151050 ACCAAGGAGAGGGAGCAAGGAGG + Intronic
1041969088 8:63716208-63716230 GCCTATGAGAGGGTGGAGGGTGG - Intergenic
1042433832 8:68741072-68741094 ACCTATCAGAGGGTGAAGGGAGG + Intronic
1043311410 8:78864327-78864349 ACCTGTGAGAGCTAGCAGGGAGG - Intergenic
1045383034 8:101645677-101645699 ACCTGGGAGACGCTTCAGGCAGG + Intronic
1047211897 8:122847342-122847364 ACCTGGGGCAGGAGGCAGGGCGG - Intronic
1047750373 8:127876029-127876051 ACCTGGCTGAGGGTGAGGGGGGG - Intergenic
1048158985 8:131993923-131993945 ACCTGTTGGAGGGTGGAGGGTGG + Intronic
1048295130 8:133208582-133208604 GCCTGGTGTAGGGTGCAGGGTGG - Intronic
1048473252 8:134721831-134721853 TGCTGGGAGAGGGCACAGGGAGG - Intergenic
1049042632 8:140124237-140124259 TCCTGGGGTAGGGTGCAGGGGGG + Intronic
1049168631 8:141143511-141143533 ACCTGGGAGACAGAGCTGGGAGG - Intronic
1049247805 8:141571983-141572005 ACATGGCAGAGGGGGCAGAGTGG + Intergenic
1049439314 8:142601971-142601993 ACCAGGGGTGGGGTGCAGGGAGG + Intergenic
1049514203 8:143044799-143044821 AGCTGGGAGAGAGGGCAAGGTGG + Exonic
1049530378 8:143151587-143151609 CCCTAGGGGAGCGTGCAGGGAGG + Intergenic
1049709475 8:144057181-144057203 GCCTGGGTGTGGGTGCACGGAGG - Intronic
1049791840 8:144475789-144475811 GCCGGGTGGAGGGTGCAGGGCGG + Exonic
1049830596 8:144699146-144699168 CCCTGGGAGATGGGGCAGTGAGG + Intergenic
1050080258 9:1908490-1908512 GCCTGTCAGAGGGTGGAGGGTGG + Intergenic
1050841388 9:10153689-10153711 ACCTCCCAGAGGGTGAAGGGTGG - Intronic
1050953874 9:11630118-11630140 ACAGGAGAGAGGGTGCAAGGAGG - Intergenic
1051427340 9:16945809-16945831 ACCAGGGAGAGGGGGCCGTGGGG + Intergenic
1052034269 9:23662334-23662356 TACTGGGGGAGGGTACAGGGGGG - Intergenic
1052306790 9:27019317-27019339 AGCTGGGAGAGGGATAAGGGAGG - Intronic
1052358513 9:27529437-27529459 ACCTGGGCGCGGGTGCAAGAAGG - Intronic
1052455363 9:28690063-28690085 ACCTGTCGGAGGGTGCGGGGTGG + Intergenic
1053593296 9:39534300-39534322 CCCTGGGGGAGGGGGCTGGGGGG - Intergenic
1053851029 9:42289008-42289030 CCCTGGGGGAGGGGGCTGGGGGG - Intergenic
1054573010 9:66830977-66830999 CCCTGGGGGAGGGGGCTGGGGGG + Intergenic
1055212315 9:73811559-73811581 GCATGGGAGATGGGGCAGGGTGG + Intergenic
1055734563 9:79313195-79313217 AACAGCAAGAGGGTGCAGGGCGG - Intergenic
1055795648 9:79972354-79972376 ATGTGGGAGAGGGTGGAGTGTGG + Intergenic
1056143624 9:83707952-83707974 ACGTGGGGGAAGGGGCAGGGAGG - Exonic
1056791313 9:89627097-89627119 GGCTGGGAGATGGTGCAGGCTGG + Intergenic
1057461573 9:95267449-95267471 ACAGGGGAGAGTGTGCAGAGAGG + Intronic
1059387320 9:113974734-113974756 ACCAGGCAGGGGGTGCAGGGGGG - Intronic
1059699391 9:116760598-116760620 ACCTGGTAGTGTGTGCAGGCTGG + Intronic
1060120137 9:120981142-120981164 AGCTGGGAGAGGAGGCAGGCAGG - Intronic
1060206161 9:121684097-121684119 AACATGGGGAGGGTGCAGGGAGG - Intronic
1060222993 9:121774223-121774245 AGCTGTGAGGGGCTGCAGGGAGG - Intronic
1060790159 9:126480521-126480543 CCCTGGGACAGGGCGGAGGGAGG + Intronic
1060829090 9:126702646-126702668 GCCCAGAAGAGGGTGCAGGGCGG - Intergenic
1061001149 9:127903723-127903745 ACCATGGAGTGGGGGCAGGGCGG + Intronic
1061203446 9:129150085-129150107 GCCTGGGTGAGGGTTCAGAGTGG + Intergenic
1061748212 9:132755486-132755508 TCCTGGGAGAGGGACCATGGAGG + Intronic
1062011408 9:134268920-134268942 GTCTGGGAGAGGCTGCAGTGAGG + Intergenic
1062181608 9:135194043-135194065 ACCAAGAAGAGGGTGCAGGTGGG + Intergenic
1062353246 9:136149260-136149282 GCCTGGGAGAGGCTGAGGGGTGG - Intergenic
1062441013 9:136569237-136569259 ACCTGCGAGGTGGGGCAGGGAGG - Intergenic
1062533975 9:137013562-137013584 ACCTGGCAGGGCGAGCAGGGAGG + Exonic
1062551786 9:137090994-137091016 GCCGGGCAGAGGGTGTAGGGTGG + Intronic
1062688209 9:137827311-137827333 AGAAGTGAGAGGGTGCAGGGAGG - Intronic
1203770457 EBV:47494-47516 ACCCGGGAGACGGTGGTGGGGGG + Intergenic
1203444426 Un_GL000219v1:42032-42054 ACCTGGAAGAAGGGGCAGAGTGG - Intergenic
1186287064 X:8056920-8056942 ACCTTTCAGAGGGTGGAGGGTGG + Intergenic
1186300293 X:8193380-8193402 ACCTACTACAGGGTGCAGGGTGG - Intergenic
1186496176 X:10014689-10014711 GCCCGGGAGCGGGTGAAGGGAGG + Intergenic
1187245779 X:17551769-17551791 ATCTGTGAAAGGGTGCAGGCAGG - Intronic
1187490727 X:19748773-19748795 TCCTGGGAGAAGGGGCAGGTTGG - Intronic
1188677075 X:32954691-32954713 ACCTGTTGGAGGGTGGAGGGTGG - Intronic
1190559243 X:51671048-51671070 GCCTGGGTGTGGGTGCAGGGAGG - Intergenic
1190565048 X:51722273-51722295 GCCTGGGTGTGGGTGCAGGGAGG + Intergenic
1190569609 X:51768212-51768234 GCCTGAGTGTGGGTGCAGGGAGG - Intergenic
1191724188 X:64261445-64261467 TGCTGGGAGAGGGGGCAGTGGGG + Intergenic
1192491610 X:71580257-71580279 AAGTGGGGGCGGGTGCAGGGTGG + Intronic
1192723487 X:73724423-73724445 ACATGGGTGAGGGTGCCTGGAGG + Intergenic
1192888994 X:75367904-75367926 ACCTATCAGAGGGTGAAGGGTGG - Intergenic
1193408480 X:81133700-81133722 ACCTATTAGAGGGTGAAGGGTGG + Intronic
1193869951 X:86784968-86784990 GCCTGCTAGAGGGTGGAGGGTGG + Intronic
1194370968 X:93070918-93070940 GCCTATGAGAGGGTGGAGGGTGG + Intergenic
1194953371 X:100152938-100152960 CCCTGGGACAGGGTGCCTGGGGG - Intergenic
1195466523 X:105185083-105185105 ACAAGGGAGAGGGTGTAGGTGGG - Intronic
1195700921 X:107705022-107705044 ACCAGGGAGAGAGTACAGAGAGG + Intergenic
1196748653 X:119094885-119094907 ACCTGGGAGATGGAGAAGGTTGG - Intronic
1197136762 X:123069721-123069743 ACCTATGGGAGGGTGGAGGGTGG + Intergenic
1198416009 X:136420434-136420456 GCCTTGCAGAGGGTGGAGGGTGG + Intergenic
1198769457 X:140114067-140114089 GCCTAGTAGAGGGTGGAGGGTGG - Intergenic
1198815065 X:140580692-140580714 GCCTGGGCCGGGGTGCAGGGAGG + Intergenic
1199224514 X:145356857-145356879 ACCTATCAGAGGGTGGAGGGTGG - Intergenic
1199721407 X:150545252-150545274 ACTTGGGATAGGATGCAGGGTGG - Intergenic
1199877001 X:151940778-151940800 ACCTGCTTGAGGGTGGAGGGTGG - Intergenic
1200034301 X:153318244-153318266 TCCTGGGAGATGGTGGAAGGAGG - Intergenic
1200055807 X:153460025-153460047 ACCTGGGAGTTGGAGGAGGGAGG - Intronic
1200207634 X:154328831-154328853 GACAGGGAAAGGGTGCAGGGGGG + Intronic
1200395128 X:155981356-155981378 ATCTGGGAGAAGCTGCAGGGTGG + Intergenic
1200678762 Y:6182810-6182832 GCCTATGAGAGGGTGGAGGGTGG + Intergenic
1201985055 Y:19957006-19957028 ATATGGGGGAGGGTGCAGTGCGG - Intergenic