ID: 1070830567

View in Genome Browser
Species Human (GRCh38)
Location 10:79415633-79415655
Sequence CAGACCTGGGAGAGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 530}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830567_1070830577 22 Left 1070830567 10:79415633-79415655 CCCTGCACCCTCTCCCAGGTCTG 0: 1
1: 0
2: 2
3: 42
4: 530
Right 1070830577 10:79415678-79415700 GCAGCTGCACTCCCAACAAATGG No data
1070830567_1070830575 0 Left 1070830567 10:79415633-79415655 CCCTGCACCCTCTCCCAGGTCTG 0: 1
1: 0
2: 2
3: 42
4: 530
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830567_1070830574 -3 Left 1070830567 10:79415633-79415655 CCCTGCACCCTCTCCCAGGTCTG 0: 1
1: 0
2: 2
3: 42
4: 530
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830567 Original CRISPR CAGACCTGGGAGAGGGTGCA GGG (reversed) Intronic
900131344 1:1088496-1088518 GAGACCCGGGGGAGGGTGCCAGG - Intronic
900356680 1:2268337-2268359 CACACCCGGGCCAGGGTGCAGGG - Intronic
900841894 1:5056683-5056705 CAGAAGTGGGGGAGGGTGAAAGG + Intergenic
900902514 1:5526696-5526718 CTTTCCTGGGAGAGGGAGCATGG + Intergenic
901661989 1:10804381-10804403 CAGATCTGGGAGAGGTGGGAGGG - Intergenic
902404644 1:16175928-16175950 GGGACCTGGGAGAGGCTTCAGGG + Intergenic
903627563 1:24742543-24742565 CAGTCCTGGGAGTGGGTGAAAGG - Intergenic
903736222 1:25531346-25531368 CAGTCCAGGGAGTGGGTGCCAGG - Intergenic
903854846 1:26331047-26331069 CAGACCAGTGAGAAGGGGCAAGG - Intronic
904068449 1:27773470-27773492 CAGGCCTGGGTGAGGCTGCCGGG + Intronic
904746874 1:32716784-32716806 CAGAGCTGGGGGAGGGGACAGGG - Intergenic
904812258 1:33171042-33171064 CAGAGCAGGAAGAGGCTGCAGGG + Intronic
904939093 1:34152360-34152382 CAGGCCTTGGTGAGGGTGCCTGG - Intronic
905102752 1:35539918-35539940 CAGACCTGGGAGATGGAGTGGGG - Intronic
905269217 1:36775953-36775975 CAGACTGGGGAGAGGGTCCAAGG - Intergenic
905350446 1:37342456-37342478 CAGCCCTGTGGGAGGCTGCAAGG + Intergenic
905459923 1:38115870-38115892 CAGCCCTGGGGGAGGGAGCGAGG + Intergenic
905971087 1:42142987-42143009 AAGGCATGGGAGTGGGTGCAGGG - Intergenic
906279822 1:44545576-44545598 AAAGCCTGGCAGAGGGTGCAAGG + Intronic
906658443 1:47565691-47565713 CAGGGCTGGGTGGGGGTGCAGGG - Intergenic
907275583 1:53314993-53315015 CAGGCCTGTGACATGGTGCATGG - Intronic
907286928 1:53386683-53386705 CAGCCTGGGGAGAGGCTGCAGGG + Intergenic
907570214 1:55476439-55476461 CAGACCTGGGAGGGGAAGGAGGG + Intergenic
908900922 1:68955574-68955596 CAGTCCTGGGAAAAGGTCCAAGG - Intergenic
910070901 1:83212592-83212614 CAGGCCTGGGAGAGGGAAAACGG - Intergenic
910851863 1:91656596-91656618 CAAACCTGGGACAGTGTGTATGG - Intergenic
911556563 1:99352438-99352460 CAGACCTGGTGGCGGGTGCCTGG - Intergenic
913647231 1:120869937-120869959 CAGAGGTGGAAGAGGGTGAAGGG - Intergenic
914079411 1:144392925-144392947 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914099768 1:144573577-144573599 CAGAGGTGGAAGAGGGTGAAGGG - Intergenic
914174310 1:145261471-145261493 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914299221 1:146364104-146364126 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914528977 1:148502655-148502677 CAGAGGTGGAAGAGGGTGAAGGG + Intergenic
914637414 1:149564453-149564475 CAGAGGTGGAAGAGGGTGAAGGG - Intergenic
915062170 1:153195219-153195241 AAGAGATTGGAGAGGGTGCAGGG - Intergenic
915286375 1:154855992-154856014 CAGGGCGGGGAGAGGGAGCATGG - Intronic
915342516 1:155184306-155184328 CAGACACGGGAGAAGGAGCAGGG - Exonic
915432908 1:155880453-155880475 GAATCCTGGCAGAGGGTGCAGGG - Intronic
915932379 1:160068565-160068587 CATGCCAGGGAGAGGGTCCAGGG - Intronic
915940465 1:160115532-160115554 CACAACTGAGAGAGGCTGCAAGG - Intergenic
916207880 1:162332793-162332815 CAGATTTGGTAGAGGGGGCAGGG - Intronic
917103920 1:171473186-171473208 CAGACAAGAGAGAGTGTGCAGGG + Intergenic
917512545 1:175680292-175680314 CAGAAAAGGGAGAGGGGGCAGGG + Intronic
918298004 1:183175762-183175784 CAGGCCTGTGCCAGGGTGCATGG + Intergenic
919322772 1:196064401-196064423 CAGACATTGGAGAGGGGACAAGG - Intergenic
919843987 1:201629423-201629445 CTGCCCTGGGAGAGGGGGCCAGG - Intronic
919940288 1:202281632-202281654 CAGGCCTCGGAGAGGGTCGATGG + Intronic
920378418 1:205521924-205521946 AACAGCTGGGAGCGGGTGCAGGG + Intronic
920451914 1:206065793-206065815 CAGACCAAGATGAGGGTGCAGGG - Intronic
920671571 1:208007429-208007451 CAGACCTGGGGGAAGGTGAGAGG - Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922740113 1:228009796-228009818 CAGCCCTGTGAGAGTGTGAAGGG + Intronic
922741527 1:228016802-228016824 CACACGCGGGAGAGGGGGCAGGG + Intronic
923540141 1:234882923-234882945 CAGAGCTGAGAGGGGCTGCACGG - Intergenic
923614523 1:235525832-235525854 CTGTCCTGGGAGTGGGTGCAGGG - Intergenic
923711454 1:236390705-236390727 CAGAGCTAGGAGAGAATGCAGGG - Intronic
923961675 1:239091688-239091710 CTGCCCTGAGGGAGGGTGCAGGG - Intergenic
924781634 1:247154371-247154393 CAGTCCTGGCAGAAGGTGAAGGG - Intronic
1063377065 10:5560844-5560866 CAGACCTGGCAGAGAATGCAGGG + Intergenic
1063392418 10:5659191-5659213 CCGCCAAGGGAGAGGGTGCAGGG - Intronic
1063555598 10:7076074-7076096 CAGCACTGGGAGATGGTGTACGG - Intergenic
1066061831 10:31730916-31730938 CTGGCCAGGGAGAGGTTGCAGGG - Intergenic
1067249351 10:44574181-44574203 CAGACTTGGGAGAGGCAGAAGGG + Intergenic
1067358128 10:45550028-45550050 CAGAGCTGGGAGCGGGGACAGGG + Intronic
1068566231 10:58578782-58578804 CACAGGTGGGAGAGGGGGCATGG - Intronic
1069684288 10:70307919-70307941 CAGACCAGTGACAGGGAGCAGGG - Intronic
1069961209 10:72080560-72080582 CACACCTGGGAGAGGGCACCTGG + Intronic
1070830567 10:79415633-79415655 CAGACCTGGGAGAGGGTGCAGGG - Intronic
1070857051 10:79614316-79614338 CAGTGCTGGGAGAGTTTGCAAGG - Exonic
1072223977 10:93350911-93350933 GAGACCTGGGAGAGGGAAGATGG - Intronic
1072453166 10:95555264-95555286 CAGTCCTGGTGGGGGGTGCAGGG + Intronic
1072620240 10:97074826-97074848 CAGCCCTGGGAGAGGATGGGGGG - Intronic
1073459542 10:103658799-103658821 CAGACCTGAGAGAGAGCTCAGGG + Intronic
1073793224 10:106960815-106960837 CAGGAATGGGAGAGGGTCCAAGG + Intronic
1074112438 10:110432010-110432032 TAGACCTGGGAAAGGGGACAGGG + Intergenic
1074871398 10:117578740-117578762 CAGAGCTGGGAAAGGGCACAAGG + Intergenic
1075728472 10:124622729-124622751 GAGACCTGGGAGAGAAGGCACGG + Exonic
1075832739 10:125425143-125425165 CAGAACTCGAGGAGGGTGCATGG - Intergenic
1075961245 10:126569029-126569051 CAGCCCGGGGGCAGGGTGCAGGG + Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076670352 10:132117594-132117616 CGGGCGTGGGCGAGGGTGCAGGG + Intronic
1076670361 10:132117618-132117640 CGGGCGTGGGCGAGGGTGCAGGG + Intronic
1076726600 10:132416865-132416887 CTGTGCTGGGAGAGAGTGCAGGG - Intronic
1076831611 10:132997401-132997423 CAGCCCTGCCAGAGGCTGCAGGG - Intergenic
1076894369 10:133302633-133302655 CATTCCTGGGTGAGGGTGCAGGG - Intronic
1076894388 10:133302696-133302718 CACCCCTGGGTCAGGGTGCAGGG - Intronic
1076917839 10:133433279-133433301 AAGACCTGGGGGAGGCTGCGCGG - Intergenic
1076937837 10:133577356-133577378 AAGACCTGGGGGAGGCTGCGCGG - Intergenic
1077020149 11:413760-413782 CAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077128301 11:955104-955126 CAAACCAGGGAGAGAGCGCAAGG + Intronic
1077280894 11:1745008-1745030 CATACCTGGGAGTGGGTGCAAGG - Intronic
1077367074 11:2165607-2165629 CAGGGCTGGGGGACGGTGCAGGG - Intronic
1077435625 11:2537601-2537623 CTGACCTGGCAGAGGGTGCCTGG - Intronic
1077523362 11:3049471-3049493 CAGACCAGGCAGATGGTGCCAGG + Intronic
1078989504 11:16632544-16632566 CAGCCCTGGGGCAGGGTGAAGGG + Intronic
1079249405 11:18776121-18776143 CATACCTGGGGGCAGGTGCAGGG - Intronic
1079303771 11:19304401-19304423 CAGTCATGGGAGAAGGTGAAGGG + Intergenic
1079968197 11:27004383-27004405 CAGCCCAGGTAGAGGTTGCATGG - Intergenic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1081812158 11:45920205-45920227 CAGAACTGGGAAGGGGAGCATGG + Intergenic
1081977244 11:47243392-47243414 CAGGCCTGGCAGAGGGTGAAAGG - Intronic
1082101851 11:48179326-48179348 CATCCCTGGGATAGGGTGCATGG + Intergenic
1083454822 11:62771633-62771655 CAGATCGGGGAGGGGGTGCGCGG - Intronic
1083898946 11:65634480-65634502 CAGACCTGGGACAGGGACCTTGG - Intronic
1084165951 11:67374762-67374784 CAGCCCTTGGAGAGGGAGGAGGG - Intronic
1084182001 11:67451461-67451483 CAGAACTGGCAGCAGGTGCAGGG + Exonic
1084315208 11:68341803-68341825 CAGATCAGGGAAATGGTGCAGGG - Intronic
1084406922 11:68979539-68979561 CACACCTGGGGAAAGGTGCACGG + Intergenic
1084490509 11:69475971-69475993 CACACCCTGGAGAGCGTGCAGGG + Intergenic
1084579765 11:70015815-70015837 AGGGCCTGGGAGAGGGTGCTGGG + Intergenic
1084618234 11:70250875-70250897 CAGAACAAGGACAGGGTGCAAGG - Intergenic
1084876799 11:72139256-72139278 CAGAGCTGTGGGAGGGGGCAGGG - Intronic
1084881863 11:72177390-72177412 CAGAGCTGTGGGAGGGGGCAGGG - Intergenic
1085044477 11:73345106-73345128 GAGACTTGGGAGAGCGTGGAGGG - Intronic
1085188112 11:74593285-74593307 CCGACCTGGGATGGGGTGCGGGG - Intronic
1085300322 11:75454600-75454622 CAGACCAGGGAGCAGGAGCAAGG + Intronic
1085308186 11:75500255-75500277 GAGAGCTGGGAAGGGGTGCAGGG - Intronic
1085451254 11:76635303-76635325 CAAACCTGGTGGAGGGCGCAGGG + Intergenic
1086121773 11:83312119-83312141 TAGACATTGGAGAGGATGCAGGG + Intergenic
1088644356 11:111904840-111904862 CAGTCATGGCAGAGGGTGAAAGG - Intergenic
1088737497 11:112739956-112739978 CTGTCCTGGGAGTGGGGGCAGGG - Intergenic
1088999028 11:115033467-115033489 CAGACCTAAGAGAGGGTTCTTGG - Intergenic
1089292693 11:117447835-117447857 CAGCTCTGGGAGAGGGTGCTAGG - Intronic
1089392111 11:118109146-118109168 GAGACCTGGGAGAGAGTGTTAGG + Intronic
1089561344 11:119344809-119344831 CAGGACTGGGAGTGGGTGGAGGG + Intronic
1090190308 11:124762435-124762457 CAGACCTGGAGGAGGCCGCAGGG - Intergenic
1090461278 11:126893692-126893714 CAGACGTGGGAGAGGGAGATTGG - Intronic
1090836774 11:130459637-130459659 CAGACCTGGCTGGGTGTGCAGGG + Intronic
1092465225 12:8725599-8725621 CAGCCCTGGCAGAGGCTGCAAGG + Intronic
1092920351 12:13225739-13225761 AAGAACTGGGAGAGGCTGCCTGG - Intergenic
1094009010 12:25786676-25786698 CAGACATGGGAGATGGTAAAAGG + Intergenic
1095950153 12:47777344-47777366 CAAAGCTGGGAGAGTGTTCAGGG + Intronic
1096670496 12:53195717-53195739 TAGTCCTGGGACAGGGAGCAGGG + Exonic
1096691663 12:53325446-53325468 GAGACCCGGGAGAGGGGGCTGGG - Intergenic
1096718094 12:53503009-53503031 CTGACCTGAGAGAGGGGGCATGG - Exonic
1100216258 12:92451855-92451877 CAGCCCTGTGTGAGGGTCCATGG - Intergenic
1100251587 12:92830325-92830347 CAGACCTGCTTGAGGGTGGAAGG - Intronic
1100734842 12:97515419-97515441 CAGACCTGGAAGACAATGCATGG + Intergenic
1100871648 12:98915977-98915999 AAGACCTAGGAGATGGTGAAGGG - Intronic
1101521364 12:105485300-105485322 CAAAGCTGGGTGAGTGTGCAAGG + Intergenic
1101593010 12:106139531-106139553 CGGAGCTGGGGGAGGGGGCAGGG + Exonic
1102033818 12:109759765-109759787 CAGGCCTTTGAGAGGTTGCAGGG - Intronic
1102060358 12:109926674-109926696 CTGAGATGGGAGAGGGTGCTGGG - Intronic
1102551092 12:113692814-113692836 CAGACCTGGCACTGGGGGCAGGG + Intergenic
1102979757 12:117232071-117232093 AAGGCCTGGAAGATGGTGCAGGG + Exonic
1103045700 12:117732904-117732926 CCGCCCTGCGAGAGGGTCCAGGG + Intronic
1103328422 12:120137126-120137148 CAGACCTGGGACAGGGGTAAGGG + Intronic
1104639148 12:130456382-130456404 GACACCTGGCAGAGGGTACAGGG - Intronic
1104669456 12:130670433-130670455 CAGAGCTAGGAGAGAGAGCAGGG - Intronic
1104859463 12:131916935-131916957 AAGACCTGTGGGAGTGTGCAGGG - Exonic
1104873059 12:132014473-132014495 AAGACCTCGGAGAGGGTCAAAGG - Intronic
1104895156 12:132160440-132160462 CAGATCTGGAAGAGGATGCCTGG - Intergenic
1105054124 12:133081255-133081277 CAGACCTGGCAGAGAGAGAAAGG - Exonic
1105481008 13:20775754-20775776 CAGACTTGGGACCAGGTGCAGGG + Intergenic
1107939179 13:45369347-45369369 CAGAGGTGGGAGACAGTGCAAGG - Intergenic
1108900141 13:55392490-55392512 CAGAGATGGGGGAGGGTGCAAGG - Intergenic
1110306000 13:73987603-73987625 CAGACGTGGGAGAGGGGAGAGGG + Intronic
1110426648 13:75374921-75374943 TGGACCTGGGGGAGGGTGCAAGG - Intronic
1112044967 13:95587435-95587457 CTGAGCTGGGAGGGTGTGCAAGG - Intronic
1114529574 14:23387490-23387512 CAGAACAGGGATGGGGTGCAGGG + Intronic
1114627110 14:24136880-24136902 CTGACCTGGGGAAGGGTGGAGGG - Intronic
1114648114 14:24266930-24266952 GAGACCTGGGAGAGGGTCCTCGG + Intronic
1115447287 14:33505856-33505878 CAGACAAGGGAGAGGGTGGTGGG - Intronic
1115963708 14:38863826-38863848 CAGACCTGGGACTGAGAGCAGGG - Intergenic
1116863813 14:50015510-50015532 CAGATGTGGCAGAGGGTGGAGGG - Intergenic
1117496789 14:56313429-56313451 CAGACAGGAGAGCGGGTGCAGGG + Intergenic
1118030831 14:61816282-61816304 CAGTCCTGGAAGAGGGTGGGTGG + Intergenic
1119415608 14:74467435-74467457 CAGCCCCAGGAGAGGGGGCAGGG + Intergenic
1119703551 14:76770633-76770655 CAGCTCTGGGGCAGGGTGCAGGG - Intronic
1119776858 14:77254293-77254315 CAGAGCTGGGAGTGAGTGCACGG + Intronic
1120890274 14:89485214-89485236 CAGACCTGGGGGAGAGTGAGGGG + Intronic
1121111065 14:91313447-91313469 CAGACCTTGGAGAGTGAGCTGGG - Exonic
1121182682 14:91941547-91941569 CACTCCCGGGAGAGGGTTCAGGG + Intronic
1122230552 14:100304630-100304652 CAAACCTGGGGCAGGGGGCATGG + Intronic
1122774583 14:104111617-104111639 CAGCCTTTGGAGAGGGTGCAGGG - Intronic
1122785758 14:104162660-104162682 CAGCCTTGGGAGGGGCTGCAGGG + Intronic
1122982738 14:105198940-105198962 CAGGCTTCGGAGAGGGTTCAGGG - Intergenic
1124003303 15:25777256-25777278 CCCACCTTTGAGAGGGTGCATGG - Intronic
1125149624 15:36517100-36517122 CAGTCCTAAGAGCGGGTGCATGG - Intergenic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1128115446 15:65102216-65102238 CAGACCTGGGGGACTGCGCAGGG + Exonic
1128233207 15:66049693-66049715 CAGAGCAGAGAGAGGGTGTAAGG - Intronic
1128317271 15:66668958-66668980 CAGACCTGCCAGTGGCTGCATGG + Intronic
1128687005 15:69694285-69694307 TAGCCCTGGGTCAGGGTGCATGG + Intergenic
1129217138 15:74106965-74106987 CAGACCTTGGTGAGGGTGTTGGG + Intronic
1129522580 15:76195178-76195200 CGGACCTGGGAGTCGGTGTAAGG - Intronic
1130297393 15:82656854-82656876 CATACCTGAGCGAGTGTGCAGGG - Intergenic
1131599104 15:93828924-93828946 CATACAGGGGAGAGGGTCCAGGG + Intergenic
1132359480 15:101200882-101200904 GAGACCTGGCAGAGGGAGGAGGG - Intronic
1132679982 16:1135919-1135941 TAGACCTTGGAGGGGGTGCACGG - Intergenic
1132772749 16:1573545-1573567 CAGAGCTGGCATAGGGGGCAGGG - Intronic
1133563561 16:6971712-6971734 CAGACCTGTGGGAGTGTGGACGG + Intronic
1133839797 16:9397393-9397415 CAGAGCTGCGTGAGGGTGGAAGG + Intergenic
1134038555 16:11050598-11050620 GAGATCTGGGAGAGGTGGCAGGG + Intronic
1135412505 16:22245731-22245753 GAGAGCTTGGAGAGGGTTCAGGG - Intronic
1136000797 16:27291318-27291340 CAGTCCTAGGAGAGGGGCCAAGG - Intergenic
1136575299 16:31120274-31120296 CACATCTGGGCGTGGGTGCAGGG + Intronic
1136708264 16:32209221-32209243 CAGGCCTGGCAGAGGGTCCCTGG - Intergenic
1138378949 16:56587101-56587123 CAGACCTGAGGGAGATTGCAGGG + Intergenic
1140122356 16:72094303-72094325 GAGGCCTGGGAGAGGGACCAAGG - Intronic
1140562877 16:76004555-76004577 CAAACCTTGGCGAGGGTGGAGGG - Intergenic
1140723278 16:77789509-77789531 AGGGCCTGGGACAGGGTGCAGGG + Intronic
1141034556 16:80616183-80616205 GAGACCTTGGACAGGGTGCCTGG + Intronic
1141585120 16:85028282-85028304 CATTCTGGGGAGAGGGTGCAAGG + Intronic
1141752751 16:85970149-85970171 CAGACGTGGGGGGTGGTGCATGG - Intergenic
1141858931 16:86703526-86703548 CAGGGCTGGGAGAGGATGCATGG + Intergenic
1142136919 16:88455770-88455792 CAAACGTGGGAGCGGGGGCAGGG + Intronic
1144329192 17:14208765-14208787 AAGAGCTGGCAGAGGGTGCGTGG + Intergenic
1144621291 17:16820168-16820190 CAGCTCTGGGAGAAGCTGCAGGG - Intergenic
1144725994 17:17503066-17503088 CCGACCCAGGAGAGGGTCCAGGG - Intergenic
1144966069 17:19078008-19078030 CAGGGTTGGGTGAGGGTGCATGG + Intergenic
1144981899 17:19174181-19174203 CAGGGTTGGGTGAGGGTGCATGG - Intergenic
1144986324 17:19204058-19204080 CAGGGTTGGGTGAGGGTGCATGG + Intergenic
1145269675 17:21398038-21398060 CAGCCCTGGCAGTGGCTGCAGGG - Intronic
1146064541 17:29623876-29623898 CACACCTGGGAGTGAGTGAATGG + Intergenic
1146514982 17:33482146-33482168 CAGTCATGGCAGAGGGTTCAAGG - Intronic
1146845712 17:36180832-36180854 CGGACCTGGGAGAAGGGGAAGGG + Intronic
1146873930 17:36392709-36392731 CGGACCTGGGAGAAGGGGAAGGG + Intronic
1146881282 17:36443621-36443643 CGGACCTGGGAGAAGGGGAAGGG + Intergenic
1146904300 17:36608322-36608344 CAGACCTGGCTGAGGGTTCTTGG - Exonic
1147065460 17:37920164-37920186 CGGACCTGGGAGAAGGGGAAGGG - Intergenic
1147477444 17:40725894-40725916 CAGGCAAGGGAGAGTGTGCAGGG - Intergenic
1147573265 17:41584482-41584504 CAGCTCTGGGAGAAGCTGCAGGG - Intronic
1148670773 17:49408530-49408552 CAGGCCTGGTATAGGGGGCAAGG - Intronic
1148863625 17:50617611-50617633 CAGCCCAGGGAGAGAGAGCAAGG + Intronic
1148977534 17:51542796-51542818 GAGACATGGGAGAAGGTGAATGG - Intergenic
1149140544 17:53428245-53428267 CTGTGATGGGAGAGGGTGCAAGG - Intergenic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1151414811 17:73955179-73955201 CAGACCTGTGCCAAGGTGCAGGG - Intergenic
1151519457 17:74617753-74617775 CATGCCTGGCAGAGGCTGCAGGG - Intronic
1151956699 17:77383692-77383714 GAGGCGTGGGAGAGGGTGCACGG + Intronic
1151994189 17:77598206-77598228 CTGACCTGGAAGGGGCTGCAGGG + Intergenic
1152230876 17:79113470-79113492 CAGGTCTGGCAGAGGGTTCAGGG - Intronic
1152291296 17:79441546-79441568 CAGATCTGGGAGAGAGGCCAGGG + Intronic
1152472121 17:80495481-80495503 CAGGCCTGGGGGAGGGCGAATGG - Intergenic
1152556330 17:81054954-81054976 CAGACACGGTAGAGGGTACAGGG - Intronic
1152745604 17:82037296-82037318 CAGCCCCGAGAGAGGGTGCGCGG + Intronic
1153894950 18:9550182-9550204 CTGACCTGGGAGGGTGAGCATGG + Exonic
1155132531 18:22952672-22952694 CTGACCTGGGAAAGGGTGAGTGG - Intronic
1156447886 18:37250412-37250434 CAGACCTAGGGGAGGGAGAAGGG - Intronic
1157493166 18:48137859-48137881 AAGGCCTGGGAGAGGGTGTTTGG - Intronic
1159252942 18:65905498-65905520 CAGCCCTGGGACAGGGCACATGG - Intergenic
1159634257 18:70785974-70785996 CAGACTTGTGAGAGCTTGCATGG + Intergenic
1160443814 18:78912454-78912476 CAGCCGTGGGAGTGGGTGCAGGG - Intergenic
1160570535 18:79814581-79814603 CAGAGCTGGGAGGGGGTGGCAGG + Intergenic
1160769495 19:823948-823970 CAGGAGTGGGAGAGTGTGCAGGG + Intergenic
1160788306 19:912066-912088 CAGACCCGGGAGTGGGGGCGCGG + Intronic
1160788378 19:912214-912236 CAGACCCGGGAGTGGGGGCGCGG + Intronic
1160828838 19:1093454-1093476 CTGACAGGGGAGAGGGGGCATGG + Intronic
1160840716 19:1145989-1146011 CAGAGCTGTGGGAGGGAGCAAGG - Intronic
1160918821 19:1510459-1510481 CAGCCCTGGGAGGGGGTCCCTGG - Intronic
1160952269 19:1673504-1673526 CAGACCAGGGAGAGGCTGACTGG - Intergenic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161167209 19:2794677-2794699 CAGGCCTGGGAGAGGGGTCCGGG + Intronic
1161257388 19:3316879-3316901 CAGAGCTGGGAGTGGGAGAAGGG + Intergenic
1161559031 19:4960581-4960603 CAGTCCTGGGAGAGGTGGCCAGG + Intronic
1161953505 19:7480409-7480431 GAGACCTGGGGGAGGGTGCCTGG - Intronic
1162064817 19:8119003-8119025 CAGACGTGGACGAGTGTGCAAGG - Exonic
1162343245 19:10105181-10105203 CAGATCTGAGAGAGGCTGCCAGG + Intergenic
1162462916 19:10823935-10823957 CCCACCTGGGAGAGGAAGCAGGG + Intronic
1162479307 19:10919511-10919533 CAGACCTGGGGGAAGGGGCAGGG + Intronic
1162568796 19:11458769-11458791 CAGATATGGGAGAGGGGACATGG + Intronic
1162731596 19:12721902-12721924 CCGAACTGGGGGAGGCTGCAAGG - Intronic
1163404893 19:17116108-17116130 CAGCCCTGTGAGGGGGTTCAAGG - Intronic
1163671120 19:18629309-18629331 CAGACCTGGTAGTGGGTGGGTGG + Intergenic
1164242593 19:23402975-23402997 TAAACCTGTGAGAAGGTGCAGGG + Intergenic
1165112164 19:33508769-33508791 CAGACCTGGGACAGGCAGAAGGG + Intronic
1165152950 19:33771699-33771721 CTGGCCTGGGAGAGGGTGGCGGG - Intronic
1165246479 19:34500918-34500940 GAGCCCTGGAAGAGGGAGCAGGG - Exonic
1166114686 19:40646714-40646736 AAGTCCTGGGAGAGGGACCAGGG - Intergenic
1166731394 19:45060930-45060952 CAGAACTGGGTGAGAGTCCAGGG - Intronic
1167459777 19:49618756-49618778 CAGGCCTGGGAAAGGGTGGAGGG - Intronic
1167962727 19:53120489-53120511 GAGACCTGTGTGAGGGTGTAAGG + Intronic
1168274042 19:55266282-55266304 CAGACCTGGGAGAGGGGGAAAGG + Exonic
1168512689 19:56986055-56986077 AAGACCTGGGGGAGGGGGAAAGG - Intergenic
1168710811 19:58498970-58498992 CAGAGCTGGGCGAGGCTGGAGGG - Intronic
925277959 2:2663714-2663736 CGGCTCTGGGAGAGGGTGCACGG - Intergenic
925325691 2:3020246-3020268 CAAACCTGTGAGAGGGTGTGTGG + Intergenic
925732629 2:6931102-6931124 CAGAACTGGGACAGTGTGCCCGG + Intronic
926148866 2:10413477-10413499 GTCACCTGGGAGAGGGTGAAGGG + Intronic
926222090 2:10943049-10943071 TCCACCTGGGAGAGGGCGCAAGG + Intergenic
926298678 2:11586973-11586995 CAGAGCTAGGACAGGGTGCAGGG + Intronic
927553577 2:24017961-24017983 CAGGGCTGGGGGAGGGGGCATGG - Intronic
928102233 2:28445805-28445827 CTGCCCAGGTAGAGGGTGCAGGG - Intergenic
928197835 2:29227986-29228008 CAGTCCTGGGAGAGGCACCATGG - Intronic
930700977 2:54457174-54457196 CAGCCCTGGGAGAGTGGGGACGG - Intronic
930858098 2:56040548-56040570 AAGAACTGGCAGAGGCTGCAAGG + Intergenic
931206452 2:60150048-60150070 CAGGACTGGGAGAGGGTACCAGG + Intergenic
931949021 2:67340649-67340671 CAGCCCTGGGAGAGCATGGAAGG - Intergenic
932398992 2:71466672-71466694 AATGCCTGGGAGAGGCTGCAGGG - Intronic
932792205 2:74663589-74663611 CAGTCATGGCAGAGGGTGAAGGG + Intronic
933465786 2:82649585-82649607 TAGACCTAGGAAAGGTTGCAAGG + Intergenic
934650195 2:96086093-96086115 CAGGCCTGGGACAGGCTGCAGGG + Intergenic
936966753 2:118134599-118134621 AAGACCTGGGAAATGGGGCATGG + Intergenic
937091733 2:119211043-119211065 CAGAGGTGGGAGAGTGTGCTAGG - Intergenic
937168134 2:119840264-119840286 GAGACCTGTGAGAGGGTGGGAGG - Intronic
937313371 2:120915745-120915767 CAGGGCTGGGAGAGGCTGCCAGG - Intronic
937345154 2:121120956-121120978 GAGAACTGGGGGAGGGAGCATGG - Intergenic
937711390 2:124984357-124984379 CAGACCCAGGAGAGGGTTCTTGG - Intergenic
937857154 2:126680691-126680713 CAGCCCAGGGAAAGGGTGAAAGG + Intronic
937916793 2:127103198-127103220 TACACCTGAGAGTGGGTGCATGG - Intronic
939614855 2:144350666-144350688 CAGTCCTGGGAGAGGAAGAAGGG + Intergenic
939709724 2:145502141-145502163 CAGACATGGGAGATGGGACACGG + Intergenic
940556930 2:155240597-155240619 TAGACATGGGAGAGGGAGAAGGG - Intergenic
941424701 2:165327955-165327977 CATACCTGGGAAGGGGTACAAGG - Intronic
942977786 2:182039800-182039822 CAGAATTGGGAGAGGGTGAGGGG - Intronic
944570416 2:201039044-201039066 CAGAGCTGGGAGAGAATGCCAGG - Intronic
945291046 2:208127914-208127936 GAGACCTGGGAGAGGCTGACTGG - Intergenic
945706962 2:213247670-213247692 TACACCAGGGACAGGGTGCAGGG - Intergenic
946236642 2:218328386-218328408 CAGAGAGGGGACAGGGTGCAGGG - Intronic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
946401262 2:219469483-219469505 CTGACCAGGGACAGGGTGCCTGG + Intronic
946584555 2:221170245-221170267 CAGACCTGGGGAAGGGAGCATGG - Intergenic
946683096 2:222238589-222238611 CAGACATGGGAGGAGGTGGAGGG + Intronic
946768005 2:223057922-223057944 CAGGTATGGGAGGGGGTGCAGGG + Intronic
947530353 2:230905137-230905159 CAGTTCTGGGAGTGGGTGGAGGG - Intergenic
947997638 2:234542320-234542342 CTGCCCTGGGAGAGGCTGCAGGG + Intergenic
947997888 2:234544193-234544215 ATGACCTTGGAGAGGGTGGAAGG + Intergenic
948076092 2:235166332-235166354 CTGTCCAGGGAGAGGGTGCAGGG - Intergenic
948349306 2:237325049-237325071 AAGGCCTGGTAGATGGTGCAGGG - Intronic
948528272 2:238586927-238586949 GTGACCTGGGAGAGAGAGCAGGG + Intergenic
948889819 2:240902098-240902120 GGGTCCTGGGAGAGGCTGCAGGG - Intergenic
1168789436 20:566315-566337 CCATCCTGAGAGAGGGTGCAGGG - Intergenic
1169298116 20:4417416-4417438 CAGAGCTGGGAGAGAGGTCACGG + Intergenic
1169961571 20:11165969-11165991 CAGCCCTGGGAGGAGGTCCAAGG - Intergenic
1170768224 20:19310057-19310079 CAGCCCTGGGAGATGGTGCCTGG + Intronic
1171453476 20:25252668-25252690 CAGGTCTGAGGGAGGGTGCAGGG + Intronic
1172012922 20:31856871-31856893 AAGGCCTGGGAGGGGTTGCAGGG + Intronic
1172098398 20:32471858-32471880 CAGACATGGCAGAAGGTGAAGGG - Intronic
1173005767 20:39138613-39138635 CAGAATTGGGGGAGGATGCATGG - Intergenic
1173688736 20:44942558-44942580 CAGACATAGGAGACTGTGCAAGG + Exonic
1173735087 20:45354961-45354983 CAGACCTTGGACAAGGTGCAAGG - Intergenic
1173800544 20:45891898-45891920 CAAACCTGGGAGGGGGGTCAGGG - Exonic
1173807798 20:45937369-45937391 CAGACCTGTGGGATGCTGCAGGG - Intronic
1175169052 20:57067158-57067180 CAGTCCTGGCAGAAGGTGAAGGG - Intergenic
1175305090 20:57970420-57970442 GACCCCTGGGAGATGGTGCAGGG - Intergenic
1175493584 20:59396053-59396075 CAGACCTGAGCAAGGATGCATGG - Intergenic
1175657288 20:60782058-60782080 CAGACCTAGGACAGGTTTCAAGG + Intergenic
1175773318 20:61637192-61637214 CTTTCCTGGGAGAGGGTGCTTGG - Intronic
1175823580 20:61924675-61924697 CTGACATGGGAGTGGGTGGAGGG - Intronic
1175935534 20:62512166-62512188 CAGGTCTGGGTGAGGGTGGAGGG + Intergenic
1175946049 20:62559249-62559271 CCACCCTGGGAGTGGGTGCAGGG + Intronic
1175986193 20:62765229-62765251 CAGACCAGGGAGAGGCTTGAAGG - Intergenic
1176427761 21:6559257-6559279 CTAGCCTGGGAGAGGGGGCATGG + Intergenic
1177798666 21:25806068-25806090 CAGCACTGGGAGATGGTGCCTGG - Intergenic
1179475558 21:41641285-41641307 TAAACCTGGCAGAGGTTGCATGG + Intergenic
1179703253 21:43167574-43167596 CTAGCCTGGGAGAGGGGGCATGG + Intergenic
1179731339 21:43369421-43369443 CAGACCTGGGCGGGAGGGCAGGG + Intergenic
1179909534 21:44440698-44440720 CAGAGCTGGGTCAGGGTGGAGGG + Intronic
1181262376 22:21607606-21607628 CAGACCTGGGTGAGGGAAAAGGG + Intronic
1181555776 22:23670973-23670995 CAGCCCTGGGGGACAGTGCAAGG + Intergenic
1181638518 22:24185251-24185273 CGGGCCTGGGTCAGGGTGCAGGG - Exonic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1183261572 22:36798920-36798942 CAGGCCTGGGAGAGGACTCAAGG - Intergenic
1183263359 22:36810618-36810640 CAGCCCAGGGAGTGAGTGCAAGG - Intronic
1183493120 22:38127275-38127297 GAGGCCGGGGACAGGGTGCAGGG + Intronic
1183571035 22:38653701-38653723 CAGACCTGGGATGGGGGGGATGG - Intronic
1184099772 22:42335977-42335999 CAGACCTGTGGGTGGGTGCCAGG - Intronic
1184108420 22:42381800-42381822 CAGAGCTGGGGGTGGGAGCAAGG - Exonic
1184279087 22:43426941-43426963 GAGGCCTGGGAGGGGCTGCAGGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185110030 22:48895628-48895650 CAGACCTGGGAGAGGAGAGAGGG + Intergenic
949937653 3:9128954-9128976 CACACCTTGGTGAGGGTGGAAGG + Intronic
950024545 3:9811134-9811156 CAGACCTGGGGAAGGGGCCAGGG - Intronic
950334459 3:12182495-12182517 CACGGCTGGGAGAGGGAGCATGG + Intronic
950504485 3:13386035-13386057 AAGGGCTGGGAGAGGGTGAAGGG + Intronic
950612861 3:14137332-14137354 CAGCCCTGGGAGAGAGAGCAAGG - Intronic
951202461 3:19890429-19890451 CAGTCCTGGGAGAGGATGGTAGG + Intronic
952088580 3:29856382-29856404 CAGATCTGGGAGATTGTGAAAGG + Intronic
952506155 3:34008408-34008430 CAGACCTGGGGGAGGGTCTCAGG + Intergenic
952511147 3:34057404-34057426 CAAACCAAGGAGAGGATGCACGG - Intergenic
953241050 3:41149842-41149864 CAGGCCTGGGAGAGACTTCAGGG + Intergenic
953478802 3:43230931-43230953 CAGGGTTGGGAGAGGTTGCAGGG + Intergenic
953850978 3:46465170-46465192 CAGAGCTGGGACAGGGCTCAGGG - Intronic
954505734 3:51070951-51070973 CGGATCGGGGGGAGGGTGCAGGG - Intronic
954611451 3:51946579-51946601 CAGACCTGGGAGGGGGTAAAAGG + Intronic
955687653 3:61562467-61562489 GAGACCCTGGAGAGGGTGGAGGG + Intronic
955770349 3:62378744-62378766 CAGACCTGGGCGGGGGCGTAGGG + Intergenic
955802703 3:62702428-62702450 CAGGCCTGGGAGACTCTGCAGGG + Intronic
956126417 3:66015044-66015066 CTGGTCTGGGAGAGGGTGCTGGG - Intronic
958606024 3:96359733-96359755 GAGACCTGCCAGAGGGTGGAAGG + Intergenic
958825218 3:99021818-99021840 TAGACCTGGGATGGGGTGCAAGG + Intergenic
960552650 3:118993842-118993864 AAGGACTGAGAGAGGGTGCAAGG + Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
962993633 3:140603242-140603264 GAGACCTGGTTTAGGGTGCATGG - Intergenic
963183918 3:142391993-142392015 AAGACCTGGAAAAGGGGGCAAGG - Intronic
963473764 3:145777360-145777382 CAGACCTGTGAGACTATGCACGG - Intergenic
965730977 3:171772498-171772520 CTGACCTGGGAGTGGGTAGAGGG - Intronic
965790319 3:172380459-172380481 CATACCTGGGTGAGGGTCTAAGG - Intronic
966095498 3:176196438-176196460 ATGACCTGGGTGTGGGTGCAAGG - Intergenic
966193341 3:177290718-177290740 CAGGCCTTGGGGAGGGGGCATGG - Intergenic
966928156 3:184658887-184658909 AAGGCCTGGGAGAGGGAGGAGGG - Intronic
967149847 3:186638533-186638555 GAGCCCTGGGAGAGGAAGCAGGG - Intronic
967255897 3:187591532-187591554 AAGAGCAGGGAGAGGGTGCTGGG - Intergenic
968086880 3:195877785-195877807 CAGGCCTGGGAGGGGGTGGTGGG + Intronic
968403179 4:316343-316365 CATACCTGGGAGAGAGAGCTGGG - Intergenic
968656615 4:1781071-1781093 CAGCCCTGGGAGGGGGAACATGG + Intergenic
968756442 4:2418549-2418571 CAGACCCGGGAGTGGGCGCTCGG + Exonic
968943734 4:3652898-3652920 CAGACCTGGGAGGGGGAGTCTGG + Intergenic
968964947 4:3765113-3765135 CGGACGGGGGCGAGGGTGCACGG + Intergenic
969382624 4:6814612-6814634 CAGACTTGTGAGAGGTTGAAAGG + Intronic
970011555 4:11464977-11464999 CAGACCTGGGAGAGTGTTACAGG + Intergenic
970457463 4:16239234-16239256 CAGAACGGGGTCAGGGTGCAAGG - Intergenic
973611187 4:52637272-52637294 TGGGCCTGGGAGAGGGTGGAGGG - Intronic
973991229 4:56409499-56409521 CAGACATGGGAAAGGGTGCCTGG - Intronic
977157128 4:93588712-93588734 CAGTACTGGGAGAAGGGGCAGGG - Intronic
981089940 4:140721984-140722006 CAGACCTGGGAGAATGGGCTAGG - Intronic
983906191 4:173184579-173184601 GAGACCAGGGAGAGGGAGCTCGG + Intronic
984327405 4:178271543-178271565 CTGAAAGGGGAGAGGGTGCAGGG - Intergenic
984403438 4:179295937-179295959 CAGACGTTGGTGAGGTTGCAGGG - Intergenic
985748653 5:1661964-1661986 CAGACCCGAGAGTGGGTGCCAGG + Intergenic
985897040 5:2754945-2754967 CACACCTAGGAAAGGGGGCAGGG - Intronic
986409664 5:7464617-7464639 CAGAGCTGGGGTGGGGTGCAGGG + Intronic
987010860 5:13762685-13762707 CAGACCTGGGTGAAGGTGGCTGG - Intronic
987305296 5:16631976-16631998 CTGAGCTGGGAGAGGCTACATGG - Intergenic
987585858 5:19855283-19855305 CAGAGCTGGGAAAGACTGCAAGG + Intronic
988081120 5:26416515-26416537 CAGACAATGGAGAGTGTGCAAGG + Intergenic
990808401 5:59693646-59693668 AAGACCTGGGAGAGGATCCAAGG + Intronic
991239827 5:64445046-64445068 CAGACCTGGGTGGGGTTCCAAGG - Intergenic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
997196481 5:131983681-131983703 CAGAGCTGGGGGAGTGAGCAGGG - Intronic
997198902 5:131997900-131997922 CAGACCTGGGAGCCACTGCAAGG + Intronic
997632521 5:135379465-135379487 CAGAACTGGAAGAGGGTGGTGGG + Intronic
997699103 5:135883924-135883946 CAGAATTGGAAGAGGCTGCAGGG - Intronic
998144105 5:139716527-139716549 CAGCCCTGGGAGATGGTTCTGGG - Intergenic
999461600 5:151761436-151761458 CAGGCTTGGGAGAGGGAGCATGG + Intronic
1000011583 5:157238383-157238405 CAGAGCTGGGAGTGGATGCCAGG + Intronic
1001115740 5:168937665-168937687 CAGACCTGGGTGAGGATCCCAGG + Intronic
1001922041 5:175608506-175608528 CAGCTCTGGGAGAGGGGGCCTGG - Intergenic
1002498988 5:179634998-179635020 CACAGCTGGGAGCGGGGGCAGGG - Intergenic
1002502688 5:179657526-179657548 CACAGCTGGGAGCGGGGGCAGGG + Intergenic
1002792689 6:447420-447442 CAGGCCAGGGAGAGGCTGCGGGG + Intergenic
1002932614 6:1644775-1644797 CAGAGCTTGCAGTGGGTGCAAGG - Intronic
1003165295 6:3672046-3672068 CAGCCCTGGGTGAGGGTGGAGGG + Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004527847 6:16426063-16426085 CAGAGCTTAGAGAGGGTGCTAGG + Intronic
1005012508 6:21349258-21349280 AAGAACTGGGAGAGAGAGCATGG - Intergenic
1005094913 6:22104189-22104211 CAGACCTGAGAGGGTGTTCAGGG + Intergenic
1006372874 6:33656305-33656327 CAGCCCTGTGCCAGGGTGCATGG + Intronic
1006455504 6:34129698-34129720 CAGGCCTGGGAGAGGGCACCCGG + Intronic
1006833898 6:36985599-36985621 CAGATACGGGAGAGGGTGGAAGG - Intronic
1007059285 6:38922377-38922399 CAGATTTGGGAAAAGGTGCATGG + Intronic
1007381483 6:41492903-41492925 CAGAGGTGGGAGAGAGTGCTGGG - Intergenic
1007581719 6:42963930-42963952 AAGCCCTGGGAGAGGGTGGGGGG - Exonic
1008660077 6:53658564-53658586 TAGACCGAGGAGAGGGTGGAAGG + Intronic
1008671163 6:53770476-53770498 CAGGCCTGGGAGCGGAGGCAGGG - Intergenic
1010254873 6:73746287-73746309 CAGCCCTGGGTGAGGGGGAAGGG + Intronic
1011078971 6:83468237-83468259 CAAACCTGGGAGAATGTGGAGGG + Intergenic
1013062608 6:106651070-106651092 CAGGGCTGGGAGAGGGTTGAAGG - Intronic
1013614639 6:111830505-111830527 CAGTGCTGGGAGAGAGTCCAGGG + Intronic
1015957623 6:138614922-138614944 CAGACCTGGGGTAGGGTGGGTGG - Intronic
1016381984 6:143493654-143493676 CAGAGATTGGAGAGGGAGCATGG - Intergenic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017209059 6:151834876-151834898 CAGGCAAGGGTGAGGGTGCAGGG + Intronic
1018167773 6:161115754-161115776 CAGAAGTGGGGGAGGGGGCATGG + Intronic
1018651889 6:165999132-165999154 CAGAGCTGGAAGAGCGGGCAGGG - Intergenic
1018656418 6:166041398-166041420 CAGCCCTGGCAGAGGAGGCAAGG + Intergenic
1018706806 6:166469531-166469553 GAGGCCGGGGAGTGGGTGCAGGG + Intronic
1018728538 6:166631827-166631849 CAGACCAGAGAGAGGCTGCGCGG + Intronic
1018756127 6:166851138-166851160 CAGGGCTGAGGGAGGGTGCAAGG + Intronic
1019034235 6:169041310-169041332 CAGAGCTGTGAGAGGGTGAGAGG - Intergenic
1019321789 7:419331-419353 CTGCCCTGGGTGAGGCTGCAGGG - Intergenic
1019321804 7:419398-419420 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321823 7:419465-419487 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321842 7:419532-419554 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321860 7:419599-419621 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321880 7:419666-419688 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321898 7:419733-419755 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321917 7:419800-419822 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321936 7:419867-419889 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321956 7:419934-419956 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321976 7:420001-420023 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019321996 7:420068-420090 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019322016 7:420135-420157 CTGCCCTGGGCGAGGCTGCAGGG - Intergenic
1019395153 7:814132-814154 CAGATGTGGTAGAGGGTGCGGGG + Intergenic
1019494755 7:1332514-1332536 CAGCCCTAGGAGAGGGAGCCAGG - Intergenic
1019522129 7:1465841-1465863 CAGAGCTGGGATACGGTGGAGGG - Intergenic
1019540819 7:1550249-1550271 CACACCTGGGACAGGGAGCCCGG - Intronic
1020007768 7:4791479-4791501 GAGTCCTGGGAGAGGAGGCAAGG + Exonic
1020009075 7:4798734-4798756 GAGTCCTGGGAGAGGAAGCAGGG + Intronic
1020468735 7:8511457-8511479 CACATCTGAGAGAGGGAGCAGGG - Intronic
1021121835 7:16804631-16804653 CAAGCCTGGGACAGGGTCCAGGG - Intronic
1021405367 7:20261554-20261576 GAGACCTGGGAGAGAAGGCAGGG - Intergenic
1021693168 7:23249301-23249323 CAAACCAGGTAAAGGGTGCATGG - Intronic
1022498597 7:30868646-30868668 CAGGGCTGGGAGAGTTTGCAAGG - Intronic
1022991723 7:35714995-35715017 CAGAACTGGCAGAGGCTGCTGGG + Intergenic
1023151841 7:37208824-37208846 CTGGCCTGGGAGAAGTTGCAGGG + Intronic
1023349817 7:39309201-39309223 CAGGACTTGGAGAGGGTCCAAGG + Intronic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1024230854 7:47362158-47362180 CAGACCAGAGTGAGGGAGCAGGG + Intronic
1024316684 7:48026510-48026532 CAGTCCTGGGTGAGGTTTCATGG - Intronic
1024520296 7:50299735-50299757 CAGAACTGGGGGAGGCTTCATGG - Intergenic
1024945781 7:54806267-54806289 CAGAGCTGGGAGGGGGAGCCAGG + Intergenic
1026054225 7:66970731-66970753 CAGCCCTGCCAGAGGTTGCAGGG + Intergenic
1026980498 7:74523928-74523950 CCGAGGTGGGAGAGGGTGGAAGG + Intronic
1027288623 7:76677457-76677479 CAGGCCTGGGAGAGGGAAAACGG - Intergenic
1027930227 7:84522756-84522778 CAGACCTGGAAAAGTGCGCAAGG - Intergenic
1028767705 7:94578657-94578679 CAGACCTGAGATCTGGTGCAAGG + Intergenic
1029158302 7:98532852-98532874 CCTACCTGGGAGATGGTTCATGG + Intergenic
1029403331 7:100358519-100358541 CAGGCATGGGGGAGGGTGGAGGG - Intronic
1029545831 7:101210157-101210179 CAGTCCTGTGAGAGGGTGGGGGG + Exonic
1029631422 7:101753224-101753246 CAGACCGGGGAGAGCCTGCACGG - Intergenic
1029657252 7:101935471-101935493 CAGAGCTGGGAAAGCGTGGACGG - Intronic
1030014084 7:105201072-105201094 CAGTCCTGGCAGAGGGTGAGGGG + Intronic
1031644147 7:124202758-124202780 CAGACCAGGTAGAGAGTCCAAGG + Intergenic
1031960990 7:127989700-127989722 AAGATCTGGGGGAGGATGCATGG - Intronic
1032075539 7:128834051-128834073 AAGACCTGGGGAAGGGTGGAGGG + Intronic
1032305856 7:130732647-130732669 CGGACCTTGGAGAGGGTGTCAGG - Exonic
1032520137 7:132537616-132537638 CAGACCCGGAAGAGGGTGGGAGG + Intronic
1035049886 7:155992574-155992596 CAGAGCTGTGGGAGGCTGCAGGG + Intergenic
1035624041 8:1058478-1058500 CTGACCTGAGAATGGGTGCATGG - Intergenic
1035782268 8:2237954-2237976 CTCTCCTGGGAGAGGGCGCACGG - Intergenic
1035809848 8:2481630-2481652 CTCTCCTGGGAGAGGGCGCACGG + Intergenic
1036021336 8:4850547-4850569 AAGTCCTGGGAGAGAGTGCTGGG - Intronic
1037935611 8:22913298-22913320 CACTGCTGGGAGAGGCTGCATGG - Intronic
1042257554 8:66821090-66821112 CAGATTGGGGAGAGGGTGCCGGG + Intronic
1043142086 8:76603138-76603160 CAGAGCTGGGAGTGAGAGCAGGG + Intergenic
1043413254 8:80021848-80021870 GAGCCCTGGGTAAGGGTGCAGGG - Intronic
1044630607 8:94274651-94274673 GAGCCCTGGGACAGGGAGCAAGG - Intergenic
1044886546 8:96784485-96784507 CACACCTGGTGGAGGGAGCAAGG + Intronic
1045554986 8:103207084-103207106 CACACCTGGGGATGGGTGCAGGG + Intronic
1045649486 8:104328847-104328869 CAGCCCTGGGGGAGGCAGCATGG - Intergenic
1047366642 8:124217427-124217449 CAGCTCTGGGAGGGGGCGCAGGG + Intergenic
1048425521 8:134319663-134319685 CAGCCCAGGGAGAGGGTGTGAGG + Intergenic
1048868131 8:138775903-138775925 TAGAAAAGGGAGAGGGTGCATGG - Intronic
1049103544 8:140597156-140597178 CAGAGCTGGGACACAGTGCAGGG - Intronic
1049332132 8:142060173-142060195 CAAACCAGTGGGAGGGTGCAGGG - Intergenic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049514202 8:143044796-143044818 CTGAGCTGGGAGAGAGGGCAAGG + Exonic
1049687971 8:143946580-143946602 CAGACCTGCCTGGGGGTGCAGGG + Intronic
1052759894 9:32579375-32579397 CAGACCCGAGAGAGGGTTCTTGG - Intergenic
1052872468 9:33521662-33521684 GAGACTGGGGAGAGGGAGCAAGG - Intergenic
1054784462 9:69197776-69197798 CAGAGCTTGGAGAGTGTGTAGGG + Intronic
1055578506 9:77683583-77683605 CAGACCAGAGAGCGTGTGCAGGG + Intergenic
1057207016 9:93179520-93179542 CAGGCCTTGGAGATGCTGCAGGG + Intergenic
1057702966 9:97376863-97376885 CAGGCCTTGGATAGTGTGCAGGG - Exonic
1058437352 9:104975293-104975315 GAGAGCTGGGAAAGGGTGCTAGG + Intergenic
1058853042 9:109032059-109032081 CAGAACTGGGAGAGGGAGAGAGG - Intronic
1058942978 9:109831344-109831366 CAGAACTGTGAGAGGCTGAAAGG - Intronic
1059387323 9:113974737-113974759 CAGACCAGGCAGGGGGTGCAGGG - Intronic
1059808165 9:117827193-117827215 CAGACCTGGGATAGAGAGAAGGG + Intergenic
1060359388 9:122940931-122940953 CAGACCTATGAGACGGGGCAGGG + Intronic
1060408885 9:123386879-123386901 GGGAACAGGGAGAGGGTGCAGGG + Intronic
1060547355 9:124469204-124469226 CACGCCTGGGAGAGGGAGAAGGG - Exonic
1061182077 9:129030274-129030296 CAGGGCTGGGAGAGGGAACAGGG - Intergenic
1061507664 9:131040691-131040713 CAGGCTGGGGAGAGGGGGCAGGG - Intronic
1061511456 9:131063650-131063672 AAGTCCTGGGAGGGGCTGCAAGG - Intronic
1061622963 9:131823725-131823747 CAGACCTGGGACAGGGAGATGGG - Intergenic
1061625634 9:131839178-131839200 CAGGCCTGGGTGAGGGAGCCAGG + Intergenic
1061859023 9:133458680-133458702 GAAACCTCGGGGAGGGTGCAGGG - Intronic
1061866180 9:133492849-133492871 CACAGCTGGCAGAGGGCGCAGGG - Intergenic
1062017088 9:134296442-134296464 TAGACCTGGGAGGGGGAGCTGGG + Intergenic
1062127030 9:134869462-134869484 CAGACCCCGCAGAGGGTGGAGGG + Intergenic
1062189586 9:135241036-135241058 CAGGCCTGGGAGAGGCTGTGAGG + Intergenic
1062320841 9:135989918-135989940 GAGCCCTGGGGGAGGCTGCAAGG + Intergenic
1062551498 9:137089540-137089562 CAGGGCTGGGAGAGGGAGCAGGG + Intronic
1062569769 9:137179696-137179718 CAGACCTGGAGAAGGGGGCAGGG + Intronic
1062686603 9:137816943-137816965 CAGGCCTGGGGGAGGGTGGCCGG - Intronic
1185511293 X:666791-666813 CAGGCCTGGGAGAGGCAGGAAGG + Intergenic
1186472759 X:9834212-9834234 CAGTCCTGGGATAGGGTGACAGG - Intronic
1190222585 X:48521928-48521950 GAGAGCTGGGGGAGGGAGCAGGG - Intronic
1190559244 X:51671051-51671073 AAGGCCTGGGTGTGGGTGCAGGG - Intergenic
1190565047 X:51722270-51722292 AAGGCCTGGGTGTGGGTGCAGGG + Intergenic
1190939984 X:55030902-55030924 CAGACCAGAGATAGGGTGCCAGG + Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193440455 X:81534812-81534834 CAGAGCACTGAGAGGGTGCAGGG - Intergenic
1194355047 X:92872643-92872665 ACGTCCTGGGAGAGGGAGCAGGG + Intergenic
1194399192 X:93421953-93421975 CAGACTTGGGATAGGGAGAAGGG - Intergenic
1195054841 X:101134264-101134286 AAGACTGGGGAGAGGATGCATGG + Intronic
1195903697 X:109824112-109824134 CAGAGCAAGGAGAGGGTCCAGGG - Intergenic
1196194869 X:112829056-112829078 CAGACCTGGAACAGGGGGCCTGG - Intronic
1200034302 X:153318247-153318269 CAGTCCTGGGAGATGGTGGAAGG - Intergenic
1200663407 Y:5989661-5989683 ACGTCCTGGGAGAGGGAGCAAGG + Intergenic
1201279899 Y:12332677-12332699 CAGACCTGAGCCACGGTGCACGG - Intergenic