ID: 1070830568

View in Genome Browser
Species Human (GRCh38)
Location 10:79415634-79415656
Sequence TCAGACCTGGGAGAGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 394}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830568_1070830575 -1 Left 1070830568 10:79415634-79415656 CCTGCACCCTCTCCCAGGTCTGA 0: 1
1: 0
2: 3
3: 34
4: 394
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830568_1070830577 21 Left 1070830568 10:79415634-79415656 CCTGCACCCTCTCCCAGGTCTGA 0: 1
1: 0
2: 3
3: 34
4: 394
Right 1070830577 10:79415678-79415700 GCAGCTGCACTCCCAACAAATGG No data
1070830568_1070830574 -4 Left 1070830568 10:79415634-79415656 CCTGCACCCTCTCCCAGGTCTGA 0: 1
1: 0
2: 3
3: 34
4: 394
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830568 Original CRISPR TCAGACCTGGGAGAGGGTGC AGG (reversed) Intronic
900164104 1:1237819-1237841 TCAGACCGGAGAGAGAGTGAGGG + Intergenic
900192662 1:1358079-1358101 CCAGGCCTGGGAGCGGGGGCTGG + Intronic
900600065 1:3499082-3499104 CCAGGCCTGAGCGAGGGTGCTGG - Intronic
901661990 1:10804382-10804404 TCAGATCTGGGAGAGGTGGGAGG - Intergenic
902651946 1:17842996-17843018 TCAGACCAGGGAGTGGGGGCTGG + Intergenic
902726085 1:18337125-18337147 TCAGAGCTGGGAGGGAGTGTAGG - Intronic
902921134 1:19666446-19666468 TCAGGCCTCGGAGACGCTGCAGG + Exonic
903177998 1:21591852-21591874 TCAGCCCTGGGCAAGGGTGCAGG - Intergenic
903999987 1:27333484-27333506 ACAGTCCTGGGTGCGGGTGCTGG + Intronic
904068448 1:27773469-27773491 ACAGGCCTGGGTGAGGCTGCCGG + Intronic
904355556 1:29936749-29936771 TCTGCTCTGGGAGAGGGTCCTGG + Intergenic
904773527 1:32893840-32893862 TCAGAACTGGGAGGCGCTGCTGG - Exonic
904823094 1:33257666-33257688 TCAGATCTGGGGGAGAGGGCCGG + Intronic
904911490 1:33937550-33937572 TCAGAGCTGGTAGAGGGTTCTGG - Intronic
905102753 1:35539919-35539941 CCAGACCTGGGAGATGGAGTGGG - Intronic
905887129 1:41497340-41497362 TCAGCCCTGGCAGAGGGAGTGGG + Intergenic
907317253 1:53580243-53580265 CCAGCCCTGAAAGAGGGTGCAGG - Intronic
907496613 1:54849567-54849589 TCAGATCTGGGCTCGGGTGCAGG - Intergenic
912748587 1:112266819-112266841 TCAGGACTGGGAGAAGATGCTGG + Intergenic
912842050 1:113047449-113047471 TCAGACCCTGGAGAGGGAGGAGG - Intergenic
913048085 1:115090043-115090065 CAAGAACTGAGAGAGGGTGCGGG + Intergenic
913338333 1:117731983-117732005 ACAGACAGGGGAGAAGGTGCTGG + Intergenic
915475215 1:156149191-156149213 TCAGGGCTGGGAGAGGGCACAGG + Intronic
915580398 1:156809605-156809627 ACAGGCCTGCGAGGGGGTGCAGG - Intronic
915622241 1:157092845-157092867 GCAGGGCTGGGACAGGGTGCGGG - Exonic
915669440 1:157476537-157476559 GTAGACCTGGGAGAGGCTGCTGG + Intergenic
915932380 1:160068566-160068588 TCATGCCAGGGAGAGGGTCCAGG - Intronic
916207881 1:162332794-162332816 TCAGATTTGGTAGAGGGGGCAGG - Intronic
917512544 1:175680291-175680313 TCAGAAAAGGGAGAGGGGGCAGG + Intronic
920041709 1:203102179-203102201 GGAGCCCTGGGAGTGGGTGCTGG + Intronic
920378417 1:205521923-205521945 TAACAGCTGGGAGCGGGTGCAGG + Intronic
920767864 1:208850770-208850792 GCAGACATGGGAGAGGATGCAGG + Intergenic
920937488 1:210449160-210449182 TCAGACATGGCAGAGGGACCCGG - Intronic
921440739 1:215182790-215182812 CCAGACCTGGGACAGAGAGCAGG - Intronic
921902277 1:220463370-220463392 TCTGAGGTTGGAGAGGGTGCTGG - Intergenic
922741526 1:228016801-228016823 TCACACGCGGGAGAGGGGGCAGG + Intronic
923009986 1:230081034-230081056 TCAAACCTGGCAGAGGAGGCTGG - Intronic
923162154 1:231323842-231323864 TCAAACCTTGGAGAGGGAGAGGG - Intergenic
923614524 1:235525833-235525855 GCTGTCCTGGGAGTGGGTGCAGG - Intergenic
1063145331 10:3290579-3290601 TCAGGCCTGGGAGTGGGGACAGG - Intergenic
1063377064 10:5560843-5560865 CCAGACCTGGCAGAGAATGCAGG + Intergenic
1063392420 10:5659192-5659214 TCCGCCAAGGGAGAGGGTGCAGG - Intronic
1063426479 10:5953903-5953925 CCAGCCCTGGTAGAAGGTGCCGG - Intronic
1063558081 10:7099719-7099741 CCTGACCTGGTGGAGGGTGCAGG - Intergenic
1064206521 10:13328820-13328842 TCAGGCCTGGGAGGTGGGGCTGG + Intronic
1066061832 10:31730917-31730939 TCTGGCCAGGGAGAGGTTGCAGG - Intergenic
1068306718 10:55220222-55220244 TCAGATCAGGGAGAGTTTGCTGG - Intronic
1070013753 10:72503427-72503449 TCATAGCTGGGGGAGGGTGTAGG + Intronic
1070337610 10:75469123-75469145 CCAAAACTGGGAGATGGTGCTGG + Intronic
1070830568 10:79415634-79415656 TCAGACCTGGGAGAGGGTGCAGG - Intronic
1072345515 10:94501304-94501326 TCAGACGTGGCAGCGTGTGCTGG + Intronic
1072620241 10:97074827-97074849 CCAGCCCTGGGAGAGGATGGGGG - Intronic
1073459541 10:103658798-103658820 TCAGACCTGAGAGAGAGCTCAGG + Intronic
1074112437 10:110432009-110432031 TTAGACCTGGGAAAGGGGACAGG + Intergenic
1074971855 10:118545470-118545492 TCAGTGTGGGGAGAGGGTGCTGG - Intergenic
1076445204 10:130509578-130509600 TCAGAGCTGGGAGAGGGCAGAGG + Intergenic
1076894370 10:133302634-133302656 CCATTCCTGGGTGAGGGTGCAGG - Intronic
1077052062 11:571443-571465 TCAGAGCTGGGGGAGGGAACAGG - Intergenic
1077434939 11:2534444-2534466 TCAGACCTCGGGGTGGGTGGAGG - Intronic
1077794077 11:5472486-5472508 TCAGAGCAGGGAGTGGGTGGAGG - Intronic
1078337974 11:10478668-10478690 TCAGGCATGGCATAGGGTGCTGG - Exonic
1078785825 11:14491371-14491393 TTAGAACTGGGAGAAGGAGCCGG + Intronic
1078927975 11:15891497-15891519 TCAGAGCTTGGAAAGGCTGCTGG - Intergenic
1078989503 11:16632543-16632565 TCAGCCCTGGGGCAGGGTGAAGG + Intronic
1083017923 11:59475515-59475537 TCACACATGGGAGATGATGCTGG - Intergenic
1083157511 11:60833709-60833731 TCATACCTGGCAGATGATGCAGG + Intergenic
1083994840 11:66266780-66266802 TCTGACCTGGCAGAGGCAGCCGG - Intronic
1084546408 11:69817233-69817255 GCATGCCTTGGAGAGGGTGCAGG - Intronic
1084579764 11:70015814-70015836 AAGGGCCTGGGAGAGGGTGCTGG + Intergenic
1085188114 11:74593286-74593308 ACCGACCTGGGATGGGGTGCGGG - Intronic
1085451253 11:76635302-76635324 TCAAACCTGGTGGAGGGCGCAGG + Intergenic
1085662748 11:78384335-78384357 TCAGTCCTGGGAGTGCTTGCAGG + Intronic
1086121772 11:83312118-83312140 TTAGACATTGGAGAGGATGCAGG + Intergenic
1086471925 11:87122848-87122870 TAATACCTGAGAGAGGGTTCAGG - Intronic
1088693589 11:112347913-112347935 TCATACCTGGCCGAGGGTGCAGG - Intergenic
1089340904 11:117756766-117756788 TCAGACCAAGGAGGGGGTGATGG + Intronic
1089535447 11:119158268-119158290 GCAGAACTGTGTGAGGGTGCTGG - Exonic
1090043377 11:123310167-123310189 TCAAATCAGGAAGAGGGTGCGGG - Intergenic
1090043387 11:123310226-123310248 TCAAATCAGGAAGAGGGTGCGGG - Intergenic
1090043397 11:123310285-123310307 TCAAATCAGGAAGAGGGTGCGGG - Intergenic
1090352015 11:126113853-126113875 GCAGGCCAGGGAGAGGTTGCAGG + Intergenic
1090662118 11:128890284-128890306 TCTGCCCTGAGAGAGGGGGCTGG + Intergenic
1091396935 12:159256-159278 CCAGACCTGGGAGGTGGTGCGGG + Intronic
1092284433 12:7120676-7120698 TTACACCAGGGAGAGGGAGCCGG + Intergenic
1092603132 12:10089089-10089111 TCTGACCTGGGGGAGGATCCTGG - Intronic
1093705918 12:22275064-22275086 TGAGACTTGGGAGAGGGAACTGG + Intronic
1096406298 12:51346481-51346503 CCTGCCCTGGGACAGGGTGCTGG + Intronic
1096460396 12:51818934-51818956 CCAGGGCTGGGAGAGGGTGAGGG - Intergenic
1096467041 12:51852288-51852310 TCAGACTTGGGAGGAGGAGCTGG + Intergenic
1096480704 12:51938996-51939018 CCTTACCTGGGAGAGGCTGCTGG + Intergenic
1096691664 12:53325447-53325469 AGAGACCCGGGAGAGGGGGCTGG - Intergenic
1101820989 12:108184195-108184217 TCAGAGCTGGCAGTAGGTGCTGG + Intronic
1102060359 12:109926675-109926697 TCTGAGATGGGAGAGGGTGCTGG - Intronic
1103761364 12:123252631-123252653 TCAGCCCTGGGTGGGGGTGGGGG + Intronic
1104072917 12:125362099-125362121 GCACACCTGGGAGCAGGTGCAGG - Intronic
1104639149 12:130456383-130456405 TGACACCTGGCAGAGGGTACAGG - Intronic
1106130953 13:26939071-26939093 TCAATCCTGGGGGAGGGTCCTGG - Intergenic
1106542029 13:30698758-30698780 TCTCACCTGAGACAGGGTGCTGG - Intergenic
1109078302 13:57865415-57865437 TCAGCCCTGGGTGAGGGAGTGGG - Intergenic
1112444704 13:99453608-99453630 TCAGAAATGGGTGAGGGTGAGGG - Intergenic
1112563991 13:100536859-100536881 TCACACCTGGCAGAGGATGGCGG - Intronic
1113792115 13:113034538-113034560 TGAGACCAGGGCGAGGGTGAGGG - Intronic
1113800287 13:113082888-113082910 ACACACCTGGGAGGGGGTTCCGG - Intronic
1113887802 13:113670172-113670194 TCAGCCCTAGGAGTGGGCGCTGG - Intronic
1114683420 14:24506193-24506215 TCCCACCTGGGAGAATGTGCCGG - Exonic
1115447288 14:33505857-33505879 GCAGACAAGGGAGAGGGTGGTGG - Intronic
1118713986 14:68546316-68546338 TCAGACCTTGGTGAGGGAGAGGG + Intronic
1119415607 14:74467434-74467456 TCAGCCCCAGGAGAGGGGGCAGG + Intergenic
1120890273 14:89485213-89485235 GCAGACCTGGGGGAGAGTGAGGG + Intronic
1121001709 14:90455791-90455813 TGGGACCAGGGTGAGGGTGCAGG + Intergenic
1121111066 14:91313448-91313470 GCAGACCTTGGAGAGTGAGCTGG - Exonic
1121331557 14:93052791-93052813 TCAGAACTGGGAAAGGGGCCGGG + Intronic
1122463530 14:101915818-101915840 ACATACCTGGGGGAGTGTGCTGG + Intronic
1122774584 14:104111618-104111640 GCAGCCTTTGGAGAGGGTGCAGG - Intronic
1122782962 14:104151361-104151383 TCAGACCTGGGTGGGGGAGCTGG + Intronic
1123701493 15:22917744-22917766 TCCCCCCAGGGAGAGGGTGCAGG + Intronic
1124722011 15:32118589-32118611 TGAGACCTGGGAGAGTGAGATGG - Intronic
1126446432 15:48750871-48750893 TCAGACTGGGGAGAGGTTGCAGG + Intronic
1128387076 15:67157479-67157501 TCTGAGCTGGGCGAGGGTCCTGG + Intronic
1129217137 15:74106964-74106986 ACAGACCTTGGTGAGGGTGTTGG + Intronic
1129693883 15:77729594-77729616 TCAGACCTGGGTCAGAGGGCTGG - Intronic
1129711822 15:77824262-77824284 GGAGACATGGGTGAGGGTGCAGG - Intergenic
1131726147 15:95227443-95227465 TCAGTCCTGTGAGAGGATGGGGG + Intergenic
1132359481 15:101200883-101200905 TGAGACCTGGCAGAGGGAGGAGG - Intronic
1132376862 15:101333955-101333977 TCTGACTTGGGACAGTGTGCAGG - Intronic
1132402361 15:101520615-101520637 ACAGAGCTCGGAGAGGCTGCAGG - Intronic
1132467731 16:85244-85266 TCAGACCCAGGAGATGGTGCAGG + Intronic
1132802229 16:1760064-1760086 TCAGGGCTGGGAGAGTGAGCCGG + Intronic
1133344624 16:5061659-5061681 CCAGGCCTGGGAGAGGGTGGGGG + Intronic
1133914509 16:10096927-10096949 TCACACCTGGGAAAGGGATCTGG - Intronic
1133967217 16:10540083-10540105 TCAAAGCTGGGAGGGGGTGCAGG + Intronic
1135330477 16:21555979-21556001 TCAGACCTGGGTGAGGTTGCCGG - Intergenic
1135649830 16:24196446-24196468 TGTGTGCTGGGAGAGGGTGCTGG + Intronic
1135910529 16:26556630-26556652 GAAGACCTGGGAGAGGGACCTGG - Intergenic
1136362625 16:29790690-29790712 TGGAACCTGGGAGAGGGGGCGGG + Intergenic
1136605651 16:31331558-31331580 GCAGACCAGGGGGAGGGGGCGGG - Intronic
1137671321 16:50281312-50281334 GCAGAGCTGGGATTGGGTGCAGG + Intronic
1137825274 16:51489512-51489534 TCAGGCCAGGGAGAGGCTGAAGG - Intergenic
1138157467 16:54719505-54719527 TCAGACCTTGGAGAGAAAGCTGG + Intergenic
1138619706 16:58201294-58201316 TCAGAGGTGGGCGAGGGTGGAGG - Intergenic
1139440291 16:66963339-66963361 ACAGCCCTGGGAGGGTGTGCGGG + Exonic
1139630358 16:68228044-68228066 TCAGGTCTGGGAAAGGGAGCTGG + Exonic
1139705999 16:68741064-68741086 TCAGACCCGGGGGAGGTGGCGGG + Intronic
1140132833 16:72179088-72179110 TGAAACCTGGGAGAAGGTGGAGG - Intergenic
1140809723 16:78565845-78565867 TCAGTCCTGAGAGATGGAGCTGG - Intronic
1141165056 16:81654772-81654794 GCAGACCCGGGCGAGGGTCCTGG - Intronic
1141685486 16:85567452-85567474 TCAGGCCTGGCAGTTGGTGCTGG + Intergenic
1141742803 16:85905252-85905274 TAAGACATGGCAGAGGGTGCTGG + Intronic
1141951698 16:87343917-87343939 TCAGAGCTGGAAGATAGTGCTGG - Intronic
1142043499 16:87910443-87910465 TCAGACCTGGGTGAGGTTGCCGG - Intronic
1142136918 16:88455769-88455791 TCAAACGTGGGAGCGGGGGCAGG + Intronic
1142220225 16:88850643-88850665 TCAGCCAGGGGAGAAGGTGCGGG + Intronic
1142883493 17:2898417-2898439 GCAGACCTGGCAGAGTGTGGGGG - Intronic
1143185016 17:5004768-5004790 TGAGACCTGGGAGAGGGGGAAGG + Intronic
1143471584 17:7179053-7179075 TCAGGCCTGGGAGGGGATGGAGG - Intronic
1146251019 17:31344425-31344447 TAAGACCTGGGATAAGGAGCTGG + Intronic
1146916327 17:36680546-36680568 CCTGACCTGGGAGAAGCTGCTGG + Intergenic
1147321701 17:39650471-39650493 GCAGACATGGGAGAGGGAGAGGG + Intronic
1147340990 17:39753299-39753321 TCACAGCTGTGTGAGGGTGCGGG - Intergenic
1148002679 17:44398934-44398956 TCAGGCCGGGGAGAAGGTCCTGG - Exonic
1151519458 17:74617754-74617776 TCATGCCTGGCAGAGGCTGCAGG - Intronic
1151836393 17:76585499-76585521 TCAAGGCTGGGAGAGGGTTCTGG + Intronic
1151994188 17:77598205-77598227 TCTGACCTGGAAGGGGCTGCAGG + Intergenic
1152230877 17:79113471-79113493 TCAGGTCTGGCAGAGGGTTCAGG - Intronic
1152854134 17:82654252-82654274 TCCGACCATCGAGAGGGTGCTGG - Intergenic
1153262524 18:3238364-3238386 TCCGACCTGGGGGAGGGGGGAGG + Intergenic
1153631342 18:7073100-7073122 GGAGAGCTGGGAGAGGGAGCAGG - Intronic
1155319158 18:24601891-24601913 TAAGACCTGGGAGTGGGGGATGG - Intergenic
1155559838 18:27063853-27063875 TCAAATCTGGGTGAGGGTGGTGG + Intronic
1156461927 18:37326098-37326120 TCTGTCCTGGGAGAGGAGGCCGG + Intronic
1157522578 18:48355576-48355598 TCAGGCCTGGGCTAGTGTGCAGG - Intronic
1157610537 18:48952320-48952342 ACAGACCCGGGAGGGGGTGGCGG - Intergenic
1160434302 18:78833614-78833636 TCCGGCTGGGGAGAGGGTGCCGG - Intergenic
1160443815 18:78912455-78912477 GCAGCCGTGGGAGTGGGTGCAGG - Intergenic
1160769494 19:823947-823969 TCAGGAGTGGGAGAGTGTGCAGG + Intergenic
1161167208 19:2794676-2794698 ACAGGCCTGGGAGAGGGGTCCGG + Intronic
1161807700 19:6454517-6454539 TCAGGCCTGGGGGAGGGGGCAGG + Intronic
1162479306 19:10919510-10919532 GCAGACCTGGGGGAAGGGGCAGG + Intronic
1163699664 19:18780980-18781002 TCCGACCAGGGAGAGGCTGGTGG + Exonic
1164279799 19:23759365-23759387 TCAGGCCTGGGAGAGGTGGTGGG + Intergenic
1165152951 19:33771700-33771722 CCTGGCCTGGGAGAGGGTGGCGG - Intronic
1165845516 19:38815613-38815635 TCAGAGCTTGGAGAAGGTGACGG + Exonic
1166144537 19:40825017-40825039 TCAGACCTGGGAGGCGGGACTGG + Intronic
1167459284 19:49615811-49615833 TCAGGCTTGGGAGGTGGTGCTGG - Exonic
1167459778 19:49618757-49618779 GCAGGCCTGGGAAAGGGTGGAGG - Intronic
1168685639 19:58347622-58347644 TGAGGCCTGGGAGGGGGTCCTGG + Exonic
925008419 2:464429-464451 ACACACCTGGGAGATGGTGGTGG - Intergenic
925318480 2:2942693-2942715 TCAGCCCTGAGACTGGGTGCAGG - Intergenic
926082868 2:10002989-10003011 TGAGAGCAGGGAGTGGGTGCTGG - Intergenic
926107317 2:10160500-10160522 GCAGACCAGGGAGAGGAGGCTGG + Intronic
926298677 2:11586972-11586994 ACAGAGCTAGGACAGGGTGCAGG + Intronic
927550615 2:23995977-23995999 TCGAACCTGGGAGGTGGTGCAGG - Intronic
927629754 2:24762870-24762892 TCAGACCTGGGTGTGAGTCCTGG + Intronic
928137915 2:28702485-28702507 TGAGGCCTGGGATGGGGTGCAGG + Intergenic
930695873 2:54411295-54411317 TCAGCCCAGGTAGAGGCTGCTGG + Intergenic
930998717 2:57755328-57755350 TCAGAACTGGGAGACACTGCAGG + Intergenic
932803521 2:74764005-74764027 TGATACCAGGGAGAGGGTGAGGG - Intergenic
933325924 2:80836839-80836861 TCAGAGCTGGCAGAGGGAGGGGG + Intergenic
933991360 2:87636294-87636316 TGAGGGCAGGGAGAGGGTGCTGG + Intergenic
934112752 2:88757651-88757673 TCAGACCAGTGTGGGGGTGCTGG - Intergenic
934650194 2:96086092-96086114 TCAGGCCTGGGACAGGCTGCAGG + Intergenic
935032750 2:99337809-99337831 TCAGGCCGGGGAAGGGGTGCCGG - Intronic
935543283 2:104374756-104374778 TCAGACTTGTGAGAAGGTGATGG - Intergenic
936163960 2:110104112-110104134 TCAGACCAGTGTGGGGGTGCTGG - Intronic
936277622 2:111114208-111114230 TCATATCTGGCAGTGGGTGCTGG + Intronic
936302482 2:111314528-111314550 TGAGGGCAGGGAGAGGGTGCTGG - Intergenic
936512689 2:113161041-113161063 TCAGACCATGGTGAGGATGCGGG + Intronic
937476549 2:122220320-122220342 TCAGACCTGTGAGATGGTGGGGG + Intergenic
937712944 2:124998528-124998550 TCATACCTGGGAGAGGTTTTCGG + Intergenic
938194948 2:129319067-129319089 TCTGAGATGGGAGTGGGTGCTGG + Intergenic
938301143 2:130213755-130213777 CCAGGCCGGGGAGAGGGCGCGGG - Intergenic
938455572 2:131460712-131460734 CCAGGCCGGGGAGAGGGCGCGGG + Intergenic
939900646 2:147845352-147845374 TCAGACCTGGGGGCGGGGGGGGG - Intronic
939986028 2:148830648-148830670 TCAGACCAGTGGGTGGGTGCTGG + Intergenic
940374187 2:152938854-152938876 ACAGTCATGGGAGAGGGTGAAGG - Intergenic
942220213 2:173761790-173761812 TCCGGCCTGGGAGATGGAGCCGG + Intergenic
942492401 2:176502796-176502818 CCAGAGGTGGGAGAGAGTGCAGG + Intergenic
942977787 2:182039801-182039823 TCAGAATTGGGAGAGGGTGAGGG - Intronic
943141435 2:183987470-183987492 TCAGTCTTGGGAAAGGCTGCTGG + Intergenic
945939011 2:215929849-215929871 TCAGAATTGAGAGAGGGTGATGG - Intergenic
946739674 2:222789362-222789384 TCAGACTCGAGAGAGGGTGTAGG + Intergenic
947550040 2:231038852-231038874 GCAGACCTGGGGGAGGCTGAGGG - Intronic
947870004 2:233429783-233429805 GCAGAGCTGGGAGAGAGTGAGGG - Intronic
947905090 2:233755322-233755344 TCTGACCTGTGCGCGGGTGCTGG - Intronic
947997637 2:234542319-234542341 CCTGCCCTGGGAGAGGCTGCAGG + Intergenic
948076093 2:235166333-235166355 ACTGTCCAGGGAGAGGGTGCAGG - Intergenic
948125874 2:235564591-235564613 TCACACCTGGCTGTGGGTGCTGG - Intronic
948125930 2:235564771-235564793 TCACACCTGGCCGTGGGTGCTGG - Intronic
948125938 2:235564801-235564823 TCACACCTGGCCGTGGGTGCTGG - Intronic
948125946 2:235564831-235564853 TCACACCTGGCCGTGGGTGCTGG - Intronic
948286781 2:236792361-236792383 TCAGACCTGGGGGATGATGTGGG + Intergenic
948469061 2:238165805-238165827 CCAGGCCTGGGAGAGGGTCCAGG + Intronic
948528271 2:238586926-238586948 TGTGACCTGGGAGAGAGAGCAGG + Intergenic
948759796 2:240183550-240183572 GCAGCCCCGGGAGAGGCTGCGGG - Intergenic
948889820 2:240902099-240902121 TGGGTCCTGGGAGAGGCTGCAGG - Intergenic
948992041 2:241560248-241560270 CCAGACCTTGGAGACGGTGGGGG - Intronic
949037002 2:241820532-241820554 TCAGAGCTGGAAGAGGCTGAAGG + Intergenic
1169423197 20:5475711-5475733 TGAGACCAGGGAGAGAATGCGGG - Intergenic
1170584185 20:17721994-17722016 TCACACCTGGGAGAGGGGGAAGG - Intronic
1171248719 20:23633330-23633352 TCAGACCAGGAGGAGGGAGCTGG - Intronic
1171255219 20:23685308-23685330 TCAGACCAGGAGGAGGGGGCTGG - Intergenic
1171258602 20:23710964-23710986 TCAGACTTGGAGGAGGGGGCTGG + Intergenic
1171265920 20:23772426-23772448 TCAGACTTGGAGGAGGGGGCTGG + Intergenic
1171278107 20:23875788-23875810 TCAGACCAGGAGGAGGGGGCTGG - Intergenic
1171283152 20:23918210-23918232 TCAGACCAGGAGGAGGGGGCTGG - Intergenic
1172046988 20:32087176-32087198 AAAGCCCTGGGAGAGGGAGCTGG + Intronic
1172095670 20:32458930-32458952 TCTGACCTGGTAGAGGCTCCAGG - Intronic
1172712829 20:36939767-36939789 TCAGACCTGGGAGAAGATGTAGG - Intronic
1175156170 20:56973087-56973109 TCACACCCGGGAGGGGATGCAGG - Intergenic
1179088759 21:38244294-38244316 ACAGACCTGGGAGAGAGAGAAGG - Intronic
1179537682 21:42062905-42062927 TCCGAGCTGCGAGAGAGTGCAGG - Intergenic
1179613930 21:42569654-42569676 ACAGACCCGGGAGAGGGGCCTGG - Intronic
1179909533 21:44440697-44440719 TCAGAGCTGGGTCAGGGTGGAGG + Intronic
1179986123 21:44921119-44921141 TCACACTTGGGAGAGGGGCCCGG + Intronic
1180977405 22:19855792-19855814 GAAGAGGTGGGAGAGGGTGCAGG + Intergenic
1181013671 22:20056440-20056462 TCAGACTGGGGACTGGGTGCAGG - Intronic
1182991771 22:34774857-34774879 TCAGACCTGGGTTAGGGCACAGG + Intergenic
1183278963 22:36922195-36922217 GCTGACCAGGGAGATGGTGCTGG + Exonic
1183350467 22:37331940-37331962 TCTGACCTGGTTGAGGATGCTGG + Intergenic
1183396908 22:37576881-37576903 TGAGAGCTGCGGGAGGGTGCAGG + Intronic
1183829305 22:40409482-40409504 CCAGTCCTGGGAGAGGCTGAAGG - Exonic
1184279086 22:43426940-43426962 TGAGGCCTGGGAGGGGCTGCAGG + Intronic
1184847181 22:47095875-47095897 CCAGCCCTGGGAAAGGGTTCTGG - Intronic
1185067029 22:48637639-48637661 ACACACCTGAGCGAGGGTGCGGG - Intronic
1185110029 22:48895627-48895649 TCAGACCTGGGAGAGGAGAGAGG + Intergenic
949231580 3:1756780-1756802 CCAGACCTGGGACAGAGAGCAGG + Intergenic
949701169 3:6760953-6760975 GGAGAGCGGGGAGAGGGTGCTGG + Intergenic
950553510 3:13681676-13681698 GAAGGCCTGGGAGCGGGTGCAGG + Intergenic
950865707 3:16187429-16187451 TCAGACCTGGCAGCTGATGCTGG + Intronic
950985758 3:17364026-17364048 TCAGTCCGGGGAGGGGGTGGTGG - Intronic
951698129 3:25467193-25467215 TCACACCTTGGAGAGGTTTCTGG + Intronic
953241049 3:41149841-41149863 TCAGGCCTGGGAGAGACTTCAGG + Intergenic
953463918 3:43103421-43103443 GCAGTGCTGGGTGAGGGTGCAGG - Intronic
953478801 3:43230930-43230952 TCAGGGTTGGGAGAGGTTGCAGG + Intergenic
954138329 3:48592500-48592522 TCAGAAGTGGGAGGGGGTACTGG + Intronic
954144786 3:48629128-48629150 TGAGACATGGGAGAGGATGAGGG - Intronic
954864079 3:53714035-53714057 TGTGACCTGTGAGAGGATGCTGG - Intronic
955802702 3:62702427-62702449 TCAGGCCTGGGAGACTCTGCAGG + Intronic
955964738 3:64377899-64377921 ACAGACCAGGGAGAGGAGGCAGG + Intronic
956126418 3:66015045-66015067 TCTGGTCTGGGAGAGGGTGCTGG - Intronic
961011141 3:123436932-123436954 TCAGACCTGGGTTAGAATGCAGG + Intronic
961522285 3:127473707-127473729 CCGGGCCTGGGAGAGGGTCCGGG - Intergenic
962279383 3:134038746-134038768 TCTCACCTGGGAAAGGGAGCGGG + Intronic
966650921 3:182300106-182300128 TCAGATCTGTGACAGGGAGCAGG - Intergenic
967255898 3:187591533-187591555 AAAGAGCAGGGAGAGGGTGCTGG - Intergenic
968045903 3:195623870-195623892 TCAGCCCTGGGGGCGGGTGGGGG + Intergenic
968086879 3:195877784-195877806 GCAGGCCTGGGAGGGGGTGGTGG + Intronic
968360774 3:198145238-198145260 TCAGTGATGGGAGGGGGTGCAGG - Intergenic
968403180 4:316344-316366 ACATACCTGGGAGAGAGAGCTGG - Intergenic
968459148 4:715286-715308 TGAGAACTGGGAGTCGGTGCTGG + Intronic
968459207 4:715636-715658 TGAGAACTGGGCGTGGGTGCTGG + Intronic
968459237 4:715812-715834 TGAGAACTGGGCGTGGGTGCTGG + Intronic
968459306 4:716203-716225 TGAGAACTGGGCGTGGGTGCTGG + Intronic
968459426 4:716909-716931 TGAGAACTGGGCGTGGGTGCTGG + Intronic
968944696 4:3657543-3657565 TGAGAGGTGGGAGAGGGAGCCGG - Intergenic
969523622 4:7693050-7693072 CCAGCCCTGGCCGAGGGTGCCGG + Intronic
970921962 4:21405080-21405102 TCAGACCTGGGAGAGGTCAGAGG - Intronic
973089467 4:46114587-46114609 TCAGATTTGGGAGTAGGTGCTGG - Intronic
974847492 4:67368210-67368232 TGAGACATTGGAGAGGGTTCTGG + Intergenic
976338500 4:83918820-83918842 TCATTCCTGGCAGAGGGAGCAGG + Intergenic
978370850 4:108028327-108028349 TCAGATTTGGGACAGGGTCCAGG + Intronic
979689889 4:123548774-123548796 TCAGACCTGCCAAAGGGTACTGG - Intergenic
981723310 4:147823138-147823160 TCAGAACTTGGAGAAGCTGCTGG + Intronic
982660586 4:158201754-158201776 TCAGACCTGGGCTAGGGCTCTGG - Intronic
985008826 4:185561794-185561816 CCAGTCCTGGGGCAGGGTGCAGG - Intergenic
985926689 5:3024777-3024799 TCATACTTGGGAGGGGCTGCCGG + Intergenic
986037970 5:3959358-3959380 CCAGTCCTGGGAAAGGGAGCTGG + Intergenic
988696683 5:33628280-33628302 TCAGAGCTGGAAGTGGGTGGAGG + Intronic
989194979 5:38707653-38707675 TCAGAGCAGGGAAAGGGTGGGGG + Intergenic
989228872 5:39064635-39064657 TGAGACCTGGGAGCGGGAGGAGG + Intronic
990336178 5:54774957-54774979 TGAGTGCTGGGAGAGGGTGTGGG - Intergenic
991940357 5:71845884-71845906 TCAGGGCAGGGAGAGGGTGAGGG - Intergenic
992093326 5:73338843-73338865 TCAGAGCGGGGAGAGGGAGGAGG + Intergenic
996012223 5:118493633-118493655 TGAGACCTGTCAGAGGGTGGAGG - Intergenic
997352423 5:133240496-133240518 TCAGGCCTGGAAGAGGGAGTTGG + Intronic
997583094 5:135029316-135029338 CCAGACCTGGGGGAGGGGACGGG + Exonic
997632520 5:135379464-135379486 CCAGAACTGGAAGAGGGTGGTGG + Intronic
998144106 5:139716528-139716550 ACAGCCCTGGGAGATGGTTCTGG - Intergenic
998352529 5:141510964-141510986 TCCACCCTGGGAGGGGGTGCCGG + Exonic
999068118 5:148714042-148714064 GCAGACCTGGGACAGGATGAAGG + Intergenic
999734021 5:154499158-154499180 TCACAGCTGGGGCAGGGTGCTGG - Intergenic
1000101673 5:158022702-158022724 TCAGACATGGCAGAGGGAGATGG - Intergenic
1000238671 5:159387988-159388010 TGAGAGCTGGGAGAGGCTCCTGG - Intergenic
1000490484 5:161906762-161906784 TCAGACCTGGGAGATGGTGGAGG - Intergenic
1001577777 5:172775354-172775376 TCTGACTTGAGAGAGGGAGCTGG + Intergenic
1002184583 5:177448078-177448100 TCAGGCCTGGGAGAGCTGGCAGG - Intronic
1002401025 5:178991675-178991697 TCAGGCTTGGCGGAGGGTGCAGG - Intronic
1002527988 5:179825690-179825712 TCAGAGCGGGGAGAAGGTGGAGG + Intronic
1002792688 6:447419-447441 CCAGGCCAGGGAGAGGCTGCGGG + Intergenic
1003165294 6:3672045-3672067 CCAGCCCTGGGTGAGGGTGGAGG + Intergenic
1003569615 6:7247387-7247409 TCAGCCCTTGAAGACGGTGCAGG + Intronic
1004304472 6:14487628-14487650 TCAGGCCTGGGAGAGCCTGAAGG + Intergenic
1004629372 6:17406896-17406918 TCAGAATTGGGTGGGGGTGCAGG - Intronic
1006447207 6:34086340-34086362 TCAGCCCTGGGAGTCGGAGCAGG + Intronic
1006472026 6:34235037-34235059 TGTGACCTGGGACGGGGTGCTGG + Intergenic
1006613924 6:35312123-35312145 AAAGACCTGGGAGAGGATCCTGG - Intronic
1007381484 6:41492904-41492926 TCAGAGGTGGGAGAGAGTGCTGG - Intergenic
1007581720 6:42963931-42963953 TAAGCCCTGGGAGAGGGTGGGGG - Exonic
1007731652 6:43951216-43951238 CCTGCCCTGGGAGAGGTTGCTGG - Intergenic
1009294593 6:61930127-61930149 TCAGACCCTGCAGAGGATGCTGG + Intronic
1011078970 6:83468236-83468258 TCAAACCTGGGAGAATGTGGAGG + Intergenic
1011590123 6:88963643-88963665 TCTGACCTCGGAAAGGGGGCGGG - Intergenic
1011657353 6:89563926-89563948 TCAGCCTTGGGTGTGGGTGCAGG - Intronic
1014242394 6:119032465-119032487 CCAGACCAGGGAGGGGGTGGGGG + Intronic
1018090137 6:160339209-160339231 GCAGACCTGGGAGGCGGGGCTGG + Intergenic
1019262266 7:88241-88263 CCAGAGCTGGGAGAGGGCGAAGG - Intergenic
1019316967 7:391315-391337 TCAGCCCTAGGGGAGGGTACGGG + Intergenic
1019395152 7:814131-814153 TCAGATGTGGTAGAGGGTGCGGG + Intergenic
1020009102 7:4798864-4798886 CCAGACCTGGCAGAGGATGCTGG - Intronic
1020209365 7:6146961-6146983 ACAGAGCTGGGTGCGGGTGCTGG - Intronic
1020245309 7:6424708-6424730 CCAGCCCTGGGAGTGGGTGCGGG - Intronic
1020468736 7:8511458-8511480 TCACATCTGAGAGAGGGAGCAGG - Intronic
1020697899 7:11438196-11438218 TCAGAACTGTGAGAGGCTGGTGG + Intronic
1021121836 7:16804632-16804654 TCAAGCCTGGGACAGGGTCCAGG - Intronic
1021405368 7:20261555-20261577 TGAGACCTGGGAGAGAAGGCAGG - Intergenic
1022875131 7:34520698-34520720 TCAGACCTGAGTGAGGGCACAGG - Intergenic
1022954782 7:35370992-35371014 TCTGAGCTGGGAGAGGGGGATGG + Intergenic
1022991722 7:35714994-35715016 GCAGAACTGGCAGAGGCTGCTGG + Intergenic
1023075200 7:36474745-36474767 TCAGGCCTGGGAGTGGGGTCTGG + Intergenic
1024230853 7:47362157-47362179 TCAGACCAGAGTGAGGGAGCAGG + Intronic
1026185478 7:68079648-68079670 TTAGCCCTGGGAGGGGGTGGGGG + Intergenic
1026760816 7:73124440-73124462 TCAGCCCTGGGAGAGGGGTCTGG + Intergenic
1026807275 7:73436193-73436215 GCAGAGCTGGCAGTGGGTGCTGG + Intergenic
1027037159 7:74933235-74933257 TCAGCCCTGGGAGAGGGGTCTGG + Intergenic
1027086404 7:75268216-75268238 TCAGCCCTGGGAGAGGGGTCTGG - Intergenic
1029392702 7:100286239-100286261 CCAGCCCTGGGAGAGGGGTCTGG - Intergenic
1029403332 7:100358520-100358542 TCAGGCATGGGGGAGGGTGGAGG - Intronic
1029545830 7:101210156-101210178 CCAGTCCTGTGAGAGGGTGGGGG + Exonic
1030014083 7:105201071-105201093 CCAGTCCTGGCAGAGGGTGAGGG + Intronic
1032993397 7:137419085-137419107 TCAGACCTGGGGAAGGGGGGAGG - Intronic
1034356045 7:150451355-150451377 TCAGCCATGGGAGAGGAGGCTGG + Intronic
1034728577 7:153363585-153363607 TCAGACCAGAGATAGGGTGCTGG + Intergenic
1035002224 7:155622186-155622208 AGAGTCCTGGAAGAGGGTGCTGG - Intronic
1035252123 7:157604282-157604304 AGAGTCCTGGGAGAGGATGCGGG - Intronic
1035338561 7:158145681-158145703 TCAGGCCTGAGAAAGTGTGCAGG - Intronic
1035647841 8:1242278-1242300 TCAGACATATGAGAGGATGCAGG + Intergenic
1036021337 8:4850548-4850570 GAAGTCCTGGGAGAGAGTGCTGG - Intronic
1036604867 8:10295793-10295815 TGAGACCTGGGAGAGGGCAGAGG - Intronic
1036700316 8:11008897-11008919 TCAGCCTTGGTAGAGGGTGATGG - Intronic
1037473913 8:19237701-19237723 CCAGACCTGCCAGCGGGTGCAGG + Intergenic
1037801345 8:22037538-22037560 GCACACCAGGGAGAGGGTGGGGG - Intergenic
1037986595 8:23294323-23294345 GCAGAGCTGGGAGAGGCTTCAGG - Intronic
1038446846 8:27610514-27610536 GCTGACCTGGGAGAGTGGGCAGG - Exonic
1038516282 8:28190334-28190356 TCCCGCCTGGGAGAGGCTGCTGG - Exonic
1038629703 8:29230216-29230238 TCAGACTTGGGTGTGAGTGCTGG - Intronic
1039053442 8:33514927-33514949 TCTGACCTGGGGTAGGGTGAGGG + Intergenic
1040474602 8:47764859-47764881 ACAGACCCGAGGGAGGGTGCGGG - Intergenic
1040798934 8:51319964-51319986 TCAGGACTGGGACAGGGAGCCGG + Exonic
1041742915 8:61176261-61176283 ACCCACCTGGGAGAGGCTGCTGG + Intronic
1042003801 8:64157688-64157710 TCAGCCCTGCGGGAGGGTTCTGG - Intergenic
1042022145 8:64379353-64379375 TCAGTCCTGGGTGGGGGTGGGGG - Intergenic
1042257553 8:66821089-66821111 ACAGATTGGGGAGAGGGTGCCGG + Intronic
1042831680 8:73036202-73036224 TCTCTCCTGGGAGAGGGTACTGG - Intronic
1043142085 8:76603137-76603159 TCAGAGCTGGGAGTGAGAGCAGG + Intergenic
1044127617 8:88477618-88477640 TCAGTCTTGGGAGAGTGTCCAGG - Intergenic
1047905911 8:129473113-129473135 TCAAACACGGAAGAGGGTGCAGG + Intergenic
1048167782 8:132078695-132078717 TCAGACCTAGGAGAGAGCCCAGG - Intronic
1048283555 8:133123404-133123426 TCAGACCCGGGAGAGACAGCAGG - Intronic
1048496947 8:134943168-134943190 TCAGAGGTGGGCAAGGGTGCAGG - Intergenic
1048960264 8:139570801-139570823 ACATTCCTGGGAGAGGTTGCTGG + Intergenic
1049272183 8:141701616-141701638 ACAGCCCTGGGCGAGGCTGCAGG - Intergenic
1049324857 8:142016606-142016628 TCAGAGCTGGGAGAGACTGTGGG - Intergenic
1050352433 9:4753226-4753248 TGACACCTGGGAAAGGGGGCAGG + Intergenic
1053917175 9:42952221-42952243 TCAGACCTGGGATTGAGGGCAGG - Intergenic
1057176058 9:93000222-93000244 TCAGAGCAGGGAGAGGGAGGTGG - Intronic
1057207015 9:93179519-93179541 TCAGGCCTTGGAGATGCTGCAGG + Intergenic
1057291453 9:93809890-93809912 GCAGACCTGGGAGAGAGGGAGGG + Intergenic
1057447879 9:95131245-95131267 TCAGGCAGGGGAGGGGGTGCTGG - Intronic
1059387324 9:113974738-113974760 ACAGACCAGGCAGGGGGTGCAGG - Intronic
1059808164 9:117827192-117827214 TCAGACCTGGGATAGAGAGAAGG + Intergenic
1060408884 9:123386878-123386900 TGGGAACAGGGAGAGGGTGCAGG + Intronic
1061622964 9:131823726-131823748 CCAGACCTGGGACAGGGAGATGG - Intergenic
1061859024 9:133458681-133458703 TGAAACCTCGGGGAGGGTGCAGG - Intronic
1061958199 9:133974500-133974522 TCACACCTGACACAGGGTGCAGG - Intronic
1061988452 9:134144142-134144164 TCAGGCCTGGGCGGGGCTGCGGG + Intronic
1062017087 9:134296441-134296463 CTAGACCTGGGAGGGGGAGCTGG + Intergenic
1062130895 9:134892505-134892527 CCAGACCTGGGAGAGGAGGATGG + Intergenic
1062551497 9:137089539-137089561 CCAGGGCTGGGAGAGGGAGCAGG + Intronic
1062690330 9:137838131-137838153 TCAGTCCTGGGAGTGTGAGCTGG + Intronic
1185527509 X:791071-791093 GCAGACCGGGGAGGGGGTGCTGG - Intergenic
1188175128 X:26979836-26979858 GCAGACCCGGGAGATGGTGATGG - Intergenic
1189581119 X:42407540-42407562 TCAGACCAGCGAGATGGAGCAGG + Intergenic
1190322701 X:49187988-49188010 ACAGACATAGCAGAGGGTGCAGG + Exonic
1192452399 X:71252541-71252563 TCAGGGCTGGGAGAGGGTGGTGG - Intronic
1193144155 X:78060025-78060047 TCAGACCCAGGAGAGGGAGGAGG + Intergenic
1193440456 X:81534813-81534835 TCAGAGCACTGAGAGGGTGCAGG - Intergenic
1194355046 X:92872642-92872664 TACGTCCTGGGAGAGGGAGCAGG + Intergenic
1194885938 X:99316281-99316303 TCTGACCTAGAAGAGGGTGGGGG - Intergenic
1194903355 X:99542860-99542882 TCAGACCTGGGATGGGGAGGGGG - Intergenic
1198960292 X:142175427-142175449 TCAGCCCTGGGAAAAGGGGCAGG - Intergenic
1199643116 X:149882154-149882176 CCAGACCTGAGAGTGGGAGCAGG - Intronic
1200129516 X:153833342-153833364 ACAGCCCTGGGAGAGCGTCCGGG + Intergenic