ID: 1070830570

View in Genome Browser
Species Human (GRCh38)
Location 10:79415640-79415662
Sequence GGCCTTTCAGACCTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830570_1070830575 -7 Left 1070830570 10:79415640-79415662 CCCTCTCCCAGGTCTGAAAGGCC 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830570_1070830577 15 Left 1070830570 10:79415640-79415662 CCCTCTCCCAGGTCTGAAAGGCC 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1070830577 10:79415678-79415700 GCAGCTGCACTCCCAACAAATGG No data
1070830570_1070830580 27 Left 1070830570 10:79415640-79415662 CCCTCTCCCAGGTCTGAAAGGCC 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1070830580 10:79415690-79415712 CCAACAAATGGTCTCATCAGAGG No data
1070830570_1070830574 -10 Left 1070830570 10:79415640-79415662 CCCTCTCCCAGGTCTGAAAGGCC 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1070830574 10:79415653-79415675 CTGAAAGGCCTTGTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830570 Original CRISPR GGCCTTTCAGACCTGGGAGA GGG (reversed) Intronic
900486381 1:2924685-2924707 GGCCTCTCAGACAGGGGACATGG - Intergenic
901649926 1:10737581-10737603 GACCTCCCAGACCTGGAAGAAGG + Intronic
901859494 1:12064815-12064837 GGGCTTGCAGAGCTGGGACAGGG - Intronic
902110919 1:14077540-14077562 GCTTTTTCAGACCTGGAAGATGG + Intergenic
902730507 1:18365727-18365749 GCCCTTGCAGACCTGGGTGTGGG + Intronic
902809413 1:18879812-18879834 GGCCTCTCAGGCCTGGGCGCTGG - Intronic
904043609 1:27598085-27598107 GGCCTTGCTGACCTGGGGGAGGG - Intronic
904237722 1:29125042-29125064 GGCTTTTAAGAGCTGGAAGAGGG - Intergenic
904585557 1:31577832-31577854 GGCTGCTCATACCTGGGAGATGG + Intronic
905964939 1:42084537-42084559 AGCCTAGCAAACCTGGGAGAAGG - Intergenic
907119104 1:51992991-51993013 CGCCTTTCAGAGGAGGGAGAAGG - Intergenic
907289497 1:53403622-53403644 GGCCTTCCACACCTGGGCAAGGG + Intergenic
907458920 1:54593799-54593821 GGCCTCCCAGACCTGGTAGGTGG + Intronic
910617303 1:89213364-89213386 TCATTTTCAGACCTGGGAGAAGG + Intergenic
912961683 1:114201645-114201667 AGCCCTTCTGACCTGGGAGAAGG + Intergenic
914742253 1:150474564-150474586 AGTCTTTCAGTCCAGGGAGAAGG - Intronic
914901722 1:151714722-151714744 AGCCTTTCAGAGAGGGGAGATGG - Intronic
916605585 1:166339303-166339325 TGCTTTTCAGACCTAGGAGAAGG - Intergenic
917952899 1:180059231-180059253 GACCTTCCAGACCTGTGAAAGGG - Intronic
918152053 1:181806075-181806097 TTTCTTCCAGACCTGGGAGATGG + Intronic
919717098 1:200790191-200790213 AGCCTAACTGACCTGGGAGAGGG - Intronic
919971180 1:202580323-202580345 GGAATTTCATCCCTGGGAGAAGG + Intronic
920350634 1:205335791-205335813 GGCCTCCCAGCCCTGGGAGGGGG + Intergenic
923052397 1:230397980-230398002 GGCCTTGCAGATCTGTGAGAGGG - Intronic
923100110 1:230807358-230807380 TGCCTTTCTGAAGTGGGAGAAGG + Intergenic
924052453 1:240092412-240092434 GGCCCTGCAGACCGGGGAGCTGG + Exonic
924309026 1:242720817-242720839 GGCCTCACAGTCCTGGCAGAAGG - Intergenic
924780383 1:247141814-247141836 GGCTTTTCAGAACTGGCAGCAGG - Intronic
1064633864 10:17344352-17344374 GGCCTCCCAGTCCTGGCAGAAGG + Intronic
1065140651 10:22715104-22715126 GGCCTTTCAGACCCTCGATATGG + Intergenic
1067370487 10:45677866-45677888 AGCATTTCAGAGCTTGGAGAGGG + Intergenic
1067762655 10:49059638-49059660 GGCATTTCAGACTTGGGTAATGG - Intronic
1067828894 10:49598615-49598637 GGCCTGTCTGACATAGGAGAGGG + Intergenic
1070113207 10:73504634-73504656 GGCCTTTCAGAACTGCTACATGG + Intronic
1070830570 10:79415640-79415662 GGCCTTTCAGACCTGGGAGAGGG - Intronic
1070904090 10:80056349-80056371 AGCTTTTCAAACCTGGGATATGG - Intergenic
1071966269 10:90856517-90856539 AGCCATTCAGACCTGGAGGAAGG + Intronic
1074346099 10:112687856-112687878 GGCCTTGCAGATCTGTGAGAAGG + Intronic
1075020241 10:118946774-118946796 GGGCTTTCTCACCTGGAAGATGG - Intergenic
1076526572 10:131115993-131116015 GGCCTTTCAGACTTCAGAGCAGG - Intronic
1076836262 10:133022498-133022520 GCCCTTTCTGACCTGGAAGTGGG + Intergenic
1077386668 11:2272451-2272473 GGGCTCTCAGACCAGGGACAGGG - Intergenic
1079122156 11:17693882-17693904 GACCTTTGAGATCTGGGGGATGG + Intergenic
1080646916 11:34194209-34194231 TGCCTTGCACACATGGGAGAGGG - Intronic
1081024036 11:37986140-37986162 AGCCTTTCTGACCTGGATGATGG + Intergenic
1081580899 11:44350959-44350981 GGCATGTCAGAGATGGGAGAAGG + Intergenic
1081625720 11:44654031-44654053 GACCTTTAAGGCCTGGGAGCTGG + Intergenic
1081748491 11:45489550-45489572 GGGCTTTCAGCCCTGGGAATTGG + Intergenic
1083609584 11:63998650-63998672 GACCTCTCAGAGCTGGGAGCGGG + Exonic
1083806535 11:65077747-65077769 GGACTCCCAGACCTGGCAGAGGG + Exonic
1084169768 11:67395500-67395522 GACCATGCAGACCAGGGAGAGGG - Intronic
1087054777 11:93922925-93922947 CGCCTTACTGACCTGGGGGAAGG + Intergenic
1087075778 11:94126228-94126250 GGACATTCAGAGCTGGGACAGGG - Intergenic
1089060978 11:115625960-115625982 GGACTTTCAGACAGGGCAGAAGG - Intergenic
1089807755 11:121106647-121106669 GGCCTTAAAGAACTGGGTGAGGG + Intronic
1090461279 11:126893699-126893721 GTGCATTCAGACGTGGGAGAGGG - Intronic
1091873127 12:3911762-3911784 GGCCTTACAATCCTGGCAGAAGG - Intergenic
1092029890 12:5275317-5275339 GGCCTCCCAGACCTGGAAGTTGG - Intergenic
1093719516 12:22422983-22423005 GGCCTTTCAGAGGATGGAGAAGG + Intronic
1093720013 12:22429623-22429645 GGCCTTTCAGAGGATGGAGAAGG + Intronic
1094009008 12:25786669-25786691 TGCCTGACAGACATGGGAGATGG + Intergenic
1103140588 12:118544663-118544685 GCCCATTCAGATCTAGGAGATGG + Intergenic
1104177823 12:126350219-126350241 GTGCTTGGAGACCTGGGAGATGG - Intergenic
1104928417 12:132325708-132325730 GACCTCTCAGACCTGGGACCTGG + Intronic
1105280370 13:18959571-18959593 GCCCTCTCTGGCCTGGGAGAGGG + Intergenic
1105337542 13:19487486-19487508 GGCCTCTCCCACTTGGGAGAGGG + Intronic
1107234722 13:38154456-38154478 GGCCTTACAGTCATGGCAGAAGG + Intergenic
1109958535 13:69601809-69601831 GGCCTTACAGTCTTGGCAGAAGG + Intergenic
1110510127 13:76340978-76341000 GGGCTTTCAGACCTTGTGGAGGG - Intergenic
1110634582 13:77751727-77751749 GGCCTTTCAGAAGAGGGAGCAGG + Intronic
1111798945 13:92959240-92959262 GGCCTCACAGTCATGGGAGAAGG + Intergenic
1112394893 13:99020387-99020409 TGCATTTTAGACCTGGGAAAGGG + Intronic
1113389808 13:109884787-109884809 AGCCTCTGAGACCTGGGAGGTGG - Intergenic
1114453946 14:22843667-22843689 GGCATTTCAGACTTAGGAGGAGG - Intronic
1115981096 14:39052203-39052225 GGCCTATAATACCTGGGTGATGG + Intronic
1118886004 14:69866329-69866351 GGCCTTTGTGTCCTGGGAGAAGG - Intronic
1119113925 14:72000600-72000622 GGTATTCCAGAACTGGGAGAGGG + Intronic
1120610693 14:86637470-86637492 GGCCTTTCAGTACTGGGAATAGG + Intergenic
1122144442 14:99681172-99681194 GGGCTTTCAGCCCTGGGACCTGG + Intergenic
1122506378 14:102234429-102234451 GGTCTTTCGGAAATGGGAGATGG - Intronic
1122826636 14:104373935-104373957 CGCCTTCCAGCCCTGGGGGACGG + Intergenic
1122979438 14:105185051-105185073 GGCCTTCCAGCCCTGGGGGACGG + Intergenic
1123053084 14:105556808-105556830 GGGTGATCAGACCTGGGAGATGG - Intergenic
1123077660 14:105677226-105677248 GGGTGATCAGACCTGGGAGATGG - Intergenic
1124783402 15:32657072-32657094 GCCCTGTCAAACCTGTGAGATGG - Intronic
1125935945 15:43635838-43635860 GGCCATTAGGAGCTGGGAGATGG + Intronic
1125948712 15:43732314-43732336 GGCCATTAGGAGCTGGGAGATGG + Intergenic
1126647880 15:50893399-50893421 TGCCTTGCAGTCATGGGAGAAGG - Intergenic
1126915565 15:53462275-53462297 GGCCTTTATGACCTTGGAGAAGG + Intergenic
1128388809 15:67168958-67168980 GCCCTTTTAGACTTGTGAGAAGG + Intronic
1130129994 15:81133086-81133108 GGCCTTTGAGTGATGGGAGAGGG - Intronic
1130561462 15:84962712-84962734 GGCCTTTGAGAGCAGGAAGAAGG + Intergenic
1133816995 16:9205063-9205085 GGCCTTGCAGAAATGGAAGATGG + Intergenic
1134191646 16:12125906-12125928 GGCCTTGCAGGCATGGGAGAAGG - Intronic
1134340940 16:13345258-13345280 GGCCTTTCAGAGGTGGAGGATGG - Intergenic
1134346072 16:13393069-13393091 AGGCTTTCAGGCCTGGGGGAAGG + Intergenic
1134631247 16:15757689-15757711 AGCCTTTCAGGACTGGGTGATGG + Intronic
1136000800 16:27291325-27291347 GGCCTGGCAGTCCTAGGAGAGGG - Intergenic
1140132837 16:72179094-72179116 GCCCTTTGAAACCTGGGAGAAGG - Intergenic
1142190078 16:88713426-88713448 GGCCTTCCTGGCCTGGGATACGG + Exonic
1142197428 16:88745250-88745272 GGCCTTTCCATCCTGGGAAAGGG + Intronic
1142921569 17:3191871-3191893 TGCCTTACAGTCCTGGAAGAGGG - Intergenic
1143130354 17:4673516-4673538 GTCCATTCCGACCTGGGAGTAGG - Intronic
1143153077 17:4818953-4818975 GGCCTTTCACTGCAGGGAGAAGG + Intronic
1143269450 17:5665069-5665091 GGCCCTGCAGACGTGGGAGTGGG + Intergenic
1143402066 17:6652306-6652328 GGCCTTTCTGTCCTGGCTGAGGG - Exonic
1145057080 17:19709865-19709887 GGCTTTTCAGACCGAGGTGATGG - Intronic
1146904303 17:36608329-36608351 AGCCCTTCAGACCTGGCTGAGGG - Exonic
1147460499 17:40565186-40565208 GCCCTTTCAGACCTGGAGAAGGG - Intronic
1147566350 17:41538706-41538728 GGCCTTGCAGACTTGGGGGAGGG + Intergenic
1147984110 17:44294677-44294699 GCCCCTTCAGATATGGGAGATGG - Intergenic
1148322033 17:46762997-46763019 GGCATTTCAGACTTGGCGGAGGG + Exonic
1148645650 17:49218411-49218433 GCCCTTTCTGACCTCGCAGAAGG - Intronic
1151194430 17:72421528-72421550 GGCCTGGCTGACCTGGTAGATGG - Intergenic
1152423561 17:80206886-80206908 GGCCCTTCTGACCTGGGCGTTGG + Intronic
1152848775 17:82618964-82618986 GGCCTTTGGGATTTGGGAGAGGG - Intronic
1152937522 17:83148995-83149017 GGCCAGTCAGACCTGGGAAAGGG + Intergenic
1153997632 18:10455184-10455206 GCCGTCTCAGCCCTGGGAGAGGG + Intronic
1156199687 18:34816153-34816175 GGCCTTCCCGAACAGGGAGATGG - Intronic
1156594607 18:38533306-38533328 GGCCTTTCTGACATTGGAGTGGG - Intergenic
1157503023 18:48204036-48204058 GCTCTTGCACACCTGGGAGATGG + Intronic
1158856847 18:61551117-61551139 GGCCTTACATACCAGGGAGTTGG - Intronic
1159262115 18:66027421-66027443 TGCCTTTCAGGCCTAGGACAAGG - Intergenic
1160537820 18:79604336-79604358 GGGCCTCCAGAGCTGGGAGAGGG - Intergenic
1160705158 19:526117-526139 TGCCTTCCAGAGCTGTGAGATGG - Intergenic
1163845385 19:19635557-19635579 CTCCCTGCAGACCTGGGAGACGG - Exonic
1164783616 19:30912581-30912603 GGCCCTTCAGACCTTGGCCATGG + Intergenic
1165334347 19:35158499-35158521 GGGCATTCAGAGCTGGGAGTAGG - Intronic
1165845515 19:38815607-38815629 GGGCTCTCAGAGCTTGGAGAAGG + Exonic
1167799326 19:51730021-51730043 GGACTTCCAGAGCTGGGAGGAGG + Intergenic
925303076 2:2830677-2830699 GGACTTTGAGACCAGGGAGCAGG - Intergenic
925598974 2:5588714-5588736 GGAATTTCAGCTCTGGGAGAAGG - Intergenic
925795198 2:7533613-7533635 GGGCTTACACACCAGGGAGATGG + Intergenic
926720991 2:15959969-15959991 GACCTATGAGACCAGGGAGATGG - Intergenic
927215953 2:20667857-20667879 GGCCAGGGAGACCTGGGAGAGGG - Intronic
928158480 2:28898267-28898289 GGCATTTCAGACATTGGACAGGG + Intronic
929098888 2:38290317-38290339 GGCCTTTCAGATCAGGTAGAGGG - Intergenic
930873414 2:56189192-56189214 AGCCTTTCAGGCCTGGCTGAGGG + Intronic
931892268 2:66686428-66686450 GGCCAGTGAGACCTGGAAGAAGG - Intergenic
932055628 2:68440427-68440449 GGCCTCACAGACCTGGTGGAAGG + Intergenic
937286680 2:120758452-120758474 GGCCTCTCAGACCTGGCTGCAGG + Intronic
937476545 2:122220314-122220336 GCAATTTCAGACCTGTGAGATGG + Intergenic
939976471 2:148722354-148722376 AGCCTATCAGACCTGGGGGAAGG - Intronic
942544533 2:177049330-177049352 GGCCTTTCAGCCCTGGGATTGGG + Intergenic
945532919 2:210978713-210978735 GGCCTTTTAGACTAGGGAAAAGG + Intergenic
945758977 2:213886960-213886982 GTGCTTTCAGAGCTGGGAGTTGG + Intronic
947685754 2:232082920-232082942 GGCCTTCCAGTCGTGGCAGAAGG + Intronic
947999048 2:234552769-234552791 GGCCTTTAAGAGCTGAGAAAGGG + Intergenic
948816859 2:240514968-240514990 TGGTCTTCAGACCTGGGAGAAGG + Intronic
949015746 2:241709361-241709383 GGCCATGCAGACCTACGAGATGG + Exonic
1169453426 20:5731686-5731708 GCCCTTTCAGGGCTGTGAGAAGG - Intergenic
1170327054 20:15168230-15168252 GGCAGTTCTGACCTTGGAGACGG + Intronic
1171168474 20:22994200-22994222 AGCCCCTCAGCCCTGGGAGAAGG + Intergenic
1173899327 20:46575644-46575666 GCCCTTGCTGACCTGGAAGAAGG - Exonic
1175266343 20:57705796-57705818 TGGCTGTCAAACCTGGGAGAGGG + Intronic
1175746713 20:61462127-61462149 GGCTTTGCAAACCTGGCAGATGG + Intronic
1176248947 20:64110958-64110980 GGCCATTAAGACCAGTGAGAGGG + Intergenic
1176736033 21:10547906-10547928 GGCCTCTCCCACTTGGGAGAGGG - Intronic
1179262000 21:39765616-39765638 GAGCTTCCAGCCCTGGGAGACGG - Exonic
1181727994 22:24824889-24824911 AGCCTTACAGTCCAGGGAGATGG - Intronic
1183533120 22:38374965-38374987 GGCCTCTCCCACTTGGGAGAGGG + Intronic
950767813 3:15286392-15286414 AGCCATTTAGAGCTGGGAGAAGG - Intronic
951266386 3:20573009-20573031 AGCCTAACTGACCTGGGAGAAGG + Intergenic
953165098 3:40457668-40457690 GGCCTTGCGGACCTGGGAGCTGG + Intronic
955770347 3:62378737-62378759 GGCTTTGCAGACCTGGGCGGGGG + Intergenic
957016993 3:75078038-75078060 GCCTTATCAGGCCTGGGAGAAGG - Intergenic
959291044 3:104474885-104474907 GGCTGTTCAGCACTGGGAGAGGG - Intergenic
959903465 3:111685077-111685099 GACATTTCAGAATTGGGAGAAGG + Intronic
960940509 3:122930019-122930041 TGCCTATCTGTCCTGGGAGAGGG + Intronic
962985761 3:140534355-140534377 GGCCTTGCAGACATGGGGGTGGG - Intronic
963440787 3:145336764-145336786 GGCCATCCAGATCTGTGAGAAGG - Intergenic
964036580 3:152206427-152206449 GGCCTTTCTGCCCTGCGTGAAGG + Intergenic
965965691 3:174486179-174486201 AGCCTAACTGACCTGGGAGAAGG - Intronic
965972806 3:174583369-174583391 GGCCATACAGACTTGGAAGAAGG + Intronic
966307680 3:178555353-178555375 GGGCTTTCACACCTGGGATTTGG + Intronic
966918932 3:184600013-184600035 GAGCTTGCAGCCCTGGGAGAGGG - Intronic
966923414 3:184629313-184629335 CGCCATTCACACCTAGGAGATGG + Intronic
967488043 3:190057031-190057053 AACCTTTCAGACATGAGAGAAGG + Intronic
967778937 3:193414698-193414720 TGCCTTTCAGACCTGCAGGACGG - Exonic
967933180 3:194705588-194705610 GCACATTCAGTCCTGGGAGAGGG + Intergenic
969663200 4:8542443-8542465 GGCCTTGAGGTCCTGGGAGAAGG + Intergenic
970343894 4:15134969-15134991 GGCCTTACAGTCATGGCAGAAGG + Intergenic
971221565 4:24712464-24712486 GGCCCTTGATACCTGGGAGGGGG + Intergenic
971287877 4:25307878-25307900 GACTTTTCAGGGCTGGGAGAAGG + Intergenic
974069289 4:57109890-57109912 GCCCTTGCTGACCTGGGTGATGG + Exonic
976116799 4:81736561-81736583 GGCCTGCCAGTCCTGGGAGCTGG + Intronic
976799604 4:88973935-88973957 GGCCTAACTGACCTGGGGGAAGG - Intronic
978318056 4:107462255-107462277 GCCCTTCTAGACCAGGGAGAAGG + Intergenic
978327314 4:107574074-107574096 GGCCTTACACACCTGAGAGCTGG - Intergenic
979535833 4:121819630-121819652 GGGATTTCAGAACTGGGATAAGG - Intronic
979984376 4:127295910-127295932 GTCCTTTCAAATCTAGGAGAAGG + Intergenic
980869921 4:138599113-138599135 GTCCTTTCACAGCTGTGAGAGGG - Intergenic
983002919 4:162441513-162441535 GGCCTTGTAGACCTGACAGATGG - Intergenic
984148901 4:176101175-176101197 AGCCTTACCTACCTGGGAGAAGG + Intronic
988815876 5:34834649-34834671 GGCCTCTCAGTCATGGTAGAAGG + Intergenic
989081792 5:37630522-37630544 GGCCTCTCCCACCTGGCAGAGGG + Intronic
992767963 5:80020150-80020172 GGCTTTTCAGCCTTGGAAGAGGG - Intronic
994763638 5:103888274-103888296 GGCATTTGAGACCAGGGAAAGGG + Intergenic
994858183 5:105153013-105153035 AGCCTATCTGACCTGGGAGAAGG - Intergenic
995051953 5:107716963-107716985 GGCCTAACTGACCTGGGGGAAGG + Intergenic
995877929 5:116810711-116810733 TTCCTTTCAGAGCTAGGAGATGG - Intergenic
999177221 5:149639993-149640015 GGCCCTACAGCCCTGGGGGAGGG + Intergenic
1000490486 5:161906768-161906790 GGGTGATCAGACCTGGGAGATGG - Intergenic
1003130802 6:3393861-3393883 GGCCTCTCAGGCCCTGGAGATGG + Intronic
1003157389 6:3608080-3608102 TGGCTTTCAGACCAGGGAGTTGG - Intergenic
1004263468 6:14129059-14129081 GGCCTTTCTGAGCTGAGGGAGGG + Intronic
1006390267 6:33754248-33754270 GGACTTTCAGACGTGGGTGGTGG + Intergenic
1007088046 6:39164407-39164429 GGCCTCTCAGAGCTTGGAGGAGG - Intergenic
1007705813 6:43790523-43790545 GGCCTTTCAGGGCCGGGAGCAGG - Intergenic
1007761969 6:44138636-44138658 GGCCTTTGAGAGCAGGGAGGAGG - Intronic
1012179991 6:96140598-96140620 GGCCTTACAAACATGGCAGAAGG + Intronic
1013901047 6:115156448-115156470 GTCCTTTCACAGCTGGGAGGCGG - Intergenic
1014972842 6:127839862-127839884 GGCCTGACAGACCTGGCAGAGGG - Intronic
1017601844 6:156092154-156092176 GGCCTCACAGACATGGCAGAAGG + Intergenic
1018373301 6:163187698-163187720 GCTCTTTTGGACCTGGGAGAAGG - Intronic
1018528772 6:164741569-164741591 GGGTGTTCAGAGCTGGGAGAGGG - Intergenic
1018914849 6:168126928-168126950 GACCTGTCTCACCTGGGAGACGG + Intergenic
1019015882 6:168879022-168879044 GGCTGTTCTGACCTGGGGGAGGG - Intergenic
1019045086 6:169139614-169139636 GGCCTTGCAGGGCTGGGAGCCGG + Intergenic
1019927561 7:4203301-4203323 GGCCTCTGCGGCCTGGGAGAGGG - Intronic
1020039865 7:4993728-4993750 GCTCTTTGAGACCTTGGAGACGG + Intronic
1023613730 7:41997192-41997214 TGCCTTTCCTTCCTGGGAGATGG - Intronic
1024135798 7:46406708-46406730 AGCCTTGCAGACCTGGGAAGGGG + Intergenic
1024255599 7:47537902-47537924 GGCCTTGCACACCTGGGGGCTGG + Intronic
1026924000 7:74176526-74176548 GGCATTTTAGACAAGGGAGAAGG - Intronic
1026927681 7:74205275-74205297 GGTCTTGCACAGCTGGGAGAGGG - Intronic
1029170871 7:98628234-98628256 GGCATGTCAGAACTGGGAGGTGG - Intronic
1029578102 7:101417397-101417419 GACCTTTCAGTCTTGGGGGATGG - Intronic
1029724130 7:102390976-102390998 GGCCTTTCATCCCAGGGAGCCGG + Intronic
1030741900 7:113119444-113119466 GGACTTTCAGACCAGGCAGGTGG - Intergenic
1031230748 7:119102798-119102820 AGCCTAACAGATCTGGGAGAAGG - Intergenic
1032197270 7:129796587-129796609 GTCCCTTCTGTCCTGGGAGAGGG + Intergenic
1034049360 7:147965960-147965982 GGCCTTACAGACTTCAGAGATGG + Intronic
1034280789 7:149852897-149852919 GGCCTTACAGAGCTGGGGGAAGG + Intronic
1034942182 7:155237696-155237718 GGGCTCTCAGCCCTGTGAGAGGG - Intergenic
1035302866 7:157908344-157908366 GGCCTTTCATGCCTGGGAGAGGG + Intronic
1037119452 8:15265875-15265897 GACCTAACAGACCTGGGGGAAGG + Intergenic
1037952475 8:23028121-23028143 GGACCCCCAGACCTGGGAGAGGG + Intronic
1038537047 8:28360884-28360906 GGCCTTTCAGCCTGGGCAGAAGG - Exonic
1040030991 8:42823485-42823507 GGCCTTTAAGACTTTGGAGCAGG - Intergenic
1042556892 8:70041219-70041241 AGCCTCTCAGAGCTGGGGGAAGG + Intergenic
1043758107 8:84029745-84029767 GGCCTTCCCCACCTTGGAGATGG - Intergenic
1045371611 8:101529775-101529797 GACCTTTCAGCCCTGGCAGGGGG + Intronic
1048687565 8:136920902-136920924 GGACTTTCTGACATGGGAGCTGG - Intergenic
1049830592 8:144699136-144699158 GGACTGTAAGCCCTGGGAGATGG + Intergenic
1054455448 9:65427964-65427986 GGGCTTTCAGAAGTGGGAAACGG - Intergenic
1056637346 9:88342253-88342275 GGACTTCCAAACCAGGGAGAAGG - Intergenic
1057016318 9:91655934-91655956 GGCTTTTCAGGCCTTGGAAAAGG + Intronic
1057873226 9:98733546-98733568 GGCCTTGCAGCCCTGGAAGTGGG - Exonic
1060800061 9:126538307-126538329 GGCCTTTCAGTTCAGTGAGAGGG - Intergenic
1061059161 9:128242118-128242140 GGCCTCAGAGAGCTGGGAGAGGG + Intronic
1203759087 EBV:2725-2747 GGCCTTTCAGACCAGGGCGGCGG + Intergenic
1185460396 X:330636-330658 GGCCTCTGTGACCTGGGGGAGGG + Intergenic
1185889937 X:3814785-3814807 GGCCTCTCCGGCCCGGGAGACGG + Intergenic
1191859357 X:65653265-65653287 GGCACTTCAAACCTGGGGGATGG + Intronic
1193980391 X:88175439-88175461 AGCCGTTCTGGCCTGGGAGATGG - Intergenic
1195933155 X:110099818-110099840 AGCCTTTCAGTCCTTGGACAAGG + Intronic
1197801826 X:130357827-130357849 GGCCTTTGAGAGCTGCAAGAAGG - Intronic
1198967110 X:142238827-142238849 GGCCTGTAAGGCCTGGGAGTTGG - Intergenic
1199680875 X:150223783-150223805 GGCCTTTCAGGAATGGGACATGG - Intergenic
1200063076 X:153492166-153492188 GGCCTCTCAGGGCTGGGAGGAGG - Intronic
1200243996 X:154513075-154513097 TCCCTTTCAGCCCTGGTAGAAGG - Intronic