ID: 1070830571

View in Genome Browser
Species Human (GRCh38)
Location 10:79415641-79415663
Sequence AGGCCTTTCAGACCTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830571_1070830577 14 Left 1070830571 10:79415641-79415663 CCTCTCCCAGGTCTGAAAGGCCT 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1070830577 10:79415678-79415700 GCAGCTGCACTCCCAACAAATGG No data
1070830571_1070830580 26 Left 1070830571 10:79415641-79415663 CCTCTCCCAGGTCTGAAAGGCCT 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1070830580 10:79415690-79415712 CCAACAAATGGTCTCATCAGAGG No data
1070830571_1070830575 -8 Left 1070830571 10:79415641-79415663 CCTCTCCCAGGTCTGAAAGGCCT 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830571 Original CRISPR AGGCCTTTCAGACCTGGGAG AGG (reversed) Intronic
900188556 1:1343913-1343935 AAGCCTATCTGACCTGGGGGTGG - Intronic
901439370 1:9268349-9268371 AGGGCTTCCAGACCAGGAAGAGG - Exonic
901859495 1:12064816-12064838 AGGGCTTGCAGAGCTGGGACAGG - Intronic
902179849 1:14679562-14679584 GTGCCTTTCAGACCTGGGGAGGG - Intronic
902730506 1:18365726-18365748 AGCCCTTGCAGACCTGGGTGTGG + Intronic
904043610 1:27598086-27598108 AGGCCTTGCTGACCTGGGGGAGG - Intronic
905281166 1:36850263-36850285 AGGACTGTCCGACCTGGGGGTGG - Intronic
905444160 1:38014225-38014247 AGGGCTTTCAGAGCTGGCTGTGG + Intronic
905775543 1:40665361-40665383 AGGCCTTGCTCGCCTGGGAGTGG - Intronic
905939848 1:41854302-41854324 TGGCCCTTCAGACCTGGGCCTGG - Intronic
907570211 1:55476431-55476453 GAGGCTTGCAGACCTGGGAGGGG + Intergenic
907650453 1:56289694-56289716 AAGCCTTTCAGACCTGCCACAGG - Intergenic
908354393 1:63316936-63316958 AGGCCTTCCAGCCCTGGCTGCGG - Intergenic
915073195 1:153288963-153288985 AAGCATTTCAGACCTGGAAAAGG + Intergenic
917966124 1:180179810-180179832 AGGCCTCTCAGCCCTGAGAGAGG + Intronic
918129280 1:181611017-181611039 ATGTCTTTCAGAACTGGTAGAGG - Intronic
918723864 1:187892379-187892401 TGTTCCTTCAGACCTGGGAGTGG + Intergenic
919717099 1:200790192-200790214 AAGCCTAACTGACCTGGGAGAGG - Intronic
920350633 1:205335790-205335812 AGGCCTCCCAGCCCTGGGAGGGG + Intergenic
921171308 1:212552460-212552482 GGCCTTTTCAGACCTGGGGGTGG - Intergenic
921574268 1:216815826-216815848 AGGCATTTAAGAGCTGGGGGCGG - Intronic
921926463 1:220713750-220713772 AGGGATTTCAGAGGTGGGAGGGG - Intergenic
923052398 1:230397981-230398003 TGGCCTTGCAGATCTGTGAGAGG - Intronic
1064162704 10:12959637-12959659 AGGACTGTCAGAGCTGGAAGGGG + Intronic
1064332436 10:14406390-14406412 AGGCCTTACAGAGCTAGGAAGGG + Intronic
1066611041 10:37248839-37248861 ATGCCTTTCACAGCTGGAAGTGG + Intronic
1067094148 10:43287263-43287285 AGGGCTTTGAGACCCTGGAGAGG + Intergenic
1067692071 10:48508433-48508455 AAGCCTTTCCCACCCGGGAGGGG + Intronic
1068379858 10:56237992-56238014 AAACCTTTCAAACCTGGAAGTGG - Intergenic
1070702693 10:78615038-78615060 AGGCACTTGGGACCTGGGAGGGG + Intergenic
1070830571 10:79415641-79415663 AGGCCTTTCAGACCTGGGAGAGG - Intronic
1071551525 10:86569774-86569796 AGGCCCTTCAGCCATGGAAGTGG - Intergenic
1072546708 10:96445630-96445652 AGCCCCTGAAGACCTGGGAGGGG - Intronic
1075040779 10:119104862-119104884 AGGCCGTACAGAGCCGGGAGTGG + Intronic
1076836261 10:133022497-133022519 GGCCCTTTCTGACCTGGAAGTGG + Intergenic
1077543239 11:3157487-3157509 AGGCTTTGCAGGCCTGGGAAGGG + Intronic
1078443282 11:11385241-11385263 AGGCGTTTGAGTCATGGGAGTGG - Intronic
1078617775 11:12881226-12881248 TGGCTTTTCGGATCTGGGAGAGG + Intronic
1079475571 11:20825822-20825844 ACACATTTCAAACCTGGGAGGGG + Intronic
1079541937 11:21587071-21587093 GGGCCTTTCAGAGAAGGGAGGGG + Intergenic
1080878222 11:36295974-36295996 AGGCCAATCAGAGCTGGGAGAGG - Intergenic
1081699137 11:45141750-45141772 AGTCCTTTCAGGCATGGGTGGGG - Intronic
1082954524 11:58855654-58855676 AGGACTTTCAGAGCTGGAAAGGG - Intronic
1083609583 11:63998649-63998671 CGACCTCTCAGAGCTGGGAGCGG + Exonic
1084110745 11:67012937-67012959 AGGCTTTTGAAACCTGGGGGGGG + Intronic
1090461280 11:126893700-126893722 AGTGCATTCAGACGTGGGAGAGG - Intronic
1090571770 11:128054986-128055008 AGGCCTTTTAGATCCTGGAGAGG - Intergenic
1090995555 11:131862844-131862866 AAGCCTTTCAGAGCGGAGAGAGG + Intronic
1093889742 12:24505797-24505819 TGGCCTTCCAGGCGTGGGAGTGG - Intergenic
1098383864 12:69898024-69898046 AGGCCTGGAAGCCCTGGGAGGGG + Intronic
1099359412 12:81681284-81681306 AGGTTTTTCACACCTTGGAGAGG - Intronic
1101858316 12:108462730-108462752 AGGCCTTTGGGAAGTGGGAGGGG - Intergenic
1102565607 12:113795451-113795473 AGGCTTCTCAGACCTGGACGGGG - Intergenic
1102634987 12:114315059-114315081 AGGCCTCTCAGACATGGAAAGGG + Intergenic
1102725525 12:115061090-115061112 AGGCATTTCACCCCTGGCAGAGG - Intergenic
1102857209 12:116304728-116304750 AGGCCTTGCAGGCCTGGGCAAGG - Intergenic
1102897942 12:116613494-116613516 AGGCCGTTCTGATATGGGAGAGG + Intergenic
1102904289 12:116662427-116662449 GGCCCCTTCAGACCTGGGAGAGG - Intergenic
1103930284 12:124446505-124446527 AGGCCTTCCTGAGCTGGCAGGGG - Intronic
1104071946 12:125353466-125353488 AGGCATTTCAGGCCGGGCAGTGG + Intronic
1104963438 12:132498707-132498729 GGGCCTTGCAGAGCTGGGTGGGG + Intronic
1104970448 12:132528448-132528470 AGGCCTTTCTGTCCGGGGTGAGG - Intronic
1106499481 13:30313636-30313658 AAGGATTTCAGACATGGGAGGGG - Intergenic
1106824933 13:33509984-33510006 AGGACTCTCTGACCTGGCAGTGG - Intergenic
1109813674 13:67549821-67549843 AGGCCATTCTGACCTGTGAGTGG + Intergenic
1110510128 13:76340979-76341001 AGGGCTTTCAGACCTTGTGGAGG - Intergenic
1111217385 13:85162551-85162573 AGGTGTTTCAGTCATGGGAGTGG - Intergenic
1112694396 13:101931517-101931539 ATGCCTTTCAGACATGGTGGAGG - Intronic
1113492065 13:110700008-110700030 AGGCCATTCCCACCTGGCAGGGG + Intronic
1113594865 13:111524018-111524040 AGGCCTGGCAGGCCTGGGAAGGG - Intergenic
1115584628 14:34798212-34798234 AGGCCTTTCAGAGCTGCGGTGGG - Intronic
1117755502 14:58970482-58970504 AGGGCTTTCAACCCTGGGAGGGG + Intergenic
1119113924 14:72000599-72000621 AGGTATTCCAGAACTGGGAGAGG + Intronic
1119128735 14:72152676-72152698 AGGCCTTTCAGAAAAGGGATGGG + Intronic
1119172118 14:72543585-72543607 AGGCATTACTGACCAGGGAGAGG + Intronic
1119401122 14:74363058-74363080 ACACCTTTCAGTCCTGGGACAGG - Intergenic
1119430763 14:74566921-74566943 AGTCCTTTCAGACCTAGGTGTGG - Intronic
1120655553 14:87185793-87185815 ATGCCTTTCAAACTTTGGAGGGG - Intergenic
1122688095 14:103519399-103519421 AGGGCATTCAGGCCTGGGTGTGG - Intergenic
1125522650 15:40356817-40356839 AGGCCTTCCTGACCTGGGGTGGG - Intergenic
1127288514 15:57550831-57550853 AGGCCTTCCAGCCCTGGGACCGG + Intergenic
1129787818 15:78320996-78321018 AGGCCTTTGAGGCCAGGGAGAGG + Intergenic
1132940832 16:2507287-2507309 AGGCCTCTCAGACCCGGGACAGG - Intronic
1135512090 16:23094363-23094385 AGGCCTTGCTGAGCTGTGAGGGG - Intronic
1136136937 16:28261988-28262010 GGCCCTTTAAGACCTGGGAGGGG + Intergenic
1137356856 16:47774829-47774851 AGGCCTTGCTGAGCTGGGATGGG + Intergenic
1139916269 16:70430271-70430293 AGCCCCTTCAGACCTGGCTGAGG - Intronic
1141158437 16:81612788-81612810 AATCCATTCAGACATGGGAGAGG - Intronic
1141158453 16:81612846-81612868 AATCCATTCAGACCTGGGAAAGG - Intronic
1141620692 16:85235353-85235375 AGGCCTCTCTGAGGTGGGAGGGG - Intergenic
1142155338 16:88530343-88530365 AGGCATGTCAGACCCGCGAGGGG - Intronic
1143269449 17:5665068-5665090 AGGCCCTGCAGACGTGGGAGTGG + Intergenic
1143402067 17:6652307-6652329 AGGCCTTTCTGTCCTGGCTGAGG - Exonic
1143958842 17:10697639-10697661 AGGCCTTTCAGCCCAGGGGCCGG + Exonic
1144045205 17:11448913-11448935 AAACATTTCAGATCTGGGAGAGG - Intronic
1144652496 17:17015859-17015881 AGGCCATTCAGGCCAGGAAGGGG + Intergenic
1146064733 17:29625236-29625258 AGGCCTGACAGAGCTGTGAGTGG + Intergenic
1147374343 17:40015176-40015198 GGGCCATTCAGGCCTGGGTGGGG + Intergenic
1147566349 17:41538705-41538727 GGGCCTTGCAGACTTGGGGGAGG + Intergenic
1148688477 17:49513535-49513557 AGGCTTGTCAGAGCTGGGAGGGG + Exonic
1149313274 17:55416856-55416878 AGGTGATTCAGTCCTGGGAGTGG + Intronic
1149584689 17:57777931-57777953 AGTCCTTTGGGCCCTGGGAGTGG - Intergenic
1151365050 17:73611715-73611737 AGGCCTTACAGAGCTGGGGTGGG - Intronic
1151597043 17:75084567-75084589 AGGCTTTTCAGGGCTGGGCGTGG + Intergenic
1152091404 17:78249672-78249694 AGGGCTTTCCCACCTTGGAGAGG + Intergenic
1152226955 17:79097176-79097198 AGCCTTTCCAGACCTGGGGGGGG - Intronic
1152252336 17:79218602-79218624 AGCCCCTTCAGAGGTGGGAGGGG - Intronic
1152937521 17:83148994-83149016 GGGCCAGTCAGACCTGGGAAAGG + Intergenic
1153444213 18:5154123-5154145 ATGTCTTTGTGACCTGGGAGTGG + Intronic
1154173031 18:12064193-12064215 AGGCCTTCCAGTCCTGTGACTGG - Intergenic
1156499201 18:37546283-37546305 CGGCCTGTGAGACCTGGGCGAGG - Intronic
1156594608 18:38533307-38533329 GGGCCTTTCTGACATTGGAGTGG - Intergenic
1157735027 18:50039865-50039887 AGTCCTTGGAGTCCTGGGAGAGG - Intronic
1164229017 19:23271587-23271609 GGGCCTATCGGACGTGGGAGAGG - Intergenic
1167015565 19:46838787-46838809 ATTCGTTTAAGACCTGGGAGAGG + Exonic
926108305 2:10166246-10166268 AGGCCTTCCAGAGCTGAGTGCGG + Intronic
927215954 2:20667858-20667880 AGGCCAGGGAGACCTGGGAGAGG - Intronic
927259275 2:21070515-21070537 AGGCCTTTTAAACCTGGGTCAGG - Intergenic
928138882 2:28710313-28710335 AGTCTTCTCAGACCTGGGGGAGG - Intergenic
929011261 2:37447500-37447522 AGGCATTGCAGAGCTGGGAAGGG - Intergenic
929098889 2:38290318-38290340 GGGCCTTTCAGATCAGGTAGAGG - Intergenic
930825467 2:55693092-55693114 ATTCGTTTAAGACCTGGGAGAGG - Intronic
931952621 2:67382166-67382188 AGGCCACTCAGGCCTGGGTGTGG - Intergenic
935862315 2:107346567-107346589 ATGCCTTTCAGACCTGAAATAGG + Intergenic
938236852 2:129712306-129712328 AGGCCTTTCACACCAGAGATTGG - Intergenic
941668851 2:168269119-168269141 AGGACTTTCAGATTTTGGAGAGG - Intergenic
942544532 2:177049329-177049351 TGGCCTTTCAGCCCTGGGATTGG + Intergenic
943993008 2:194721428-194721450 TGGCCTGTCAGTGCTGGGAGGGG - Intergenic
944893324 2:204139635-204139657 AGGTGTTTGAGACATGGGAGCGG + Intergenic
946860876 2:223999466-223999488 AGGCCTTTTACACGGGGGAGGGG + Intronic
947500663 2:230668603-230668625 AGGCTTTGCAGATCTGGAAGGGG + Intergenic
947740034 2:232480793-232480815 AGGCCTATCAGAAGTGGGTGCGG - Exonic
948856739 2:240733764-240733786 AGGCCTTTCAGACCAATGATGGG - Intronic
1168975459 20:1962406-1962428 AGACCTATCAGACATGGGGGAGG + Intergenic
1169235903 20:3929672-3929694 AGGCTGCTCAGAGCTGGGAGAGG + Intronic
1172710632 20:36920474-36920496 AGGGCTGTCAGGCCTGGGTGCGG + Intronic
1176248946 20:64110957-64110979 AGGCCATTAAGACCAGTGAGAGG + Intergenic
1177719467 21:24886006-24886028 TGGCCTTGCAGATCTGGCAGAGG + Intergenic
1179229583 21:39489377-39489399 ATGCCTGTCAGAGATGGGAGTGG + Intronic
1179885393 21:44312136-44312158 AGGCCTTTACCACCAGGGAGGGG + Exonic
1179921350 21:44509342-44509364 AGGTCTTCCAGATCGGGGAGAGG - Exonic
1185052635 22:48561892-48561914 AGTCCTTTCTGTCCTGGGACTGG + Intronic
1185110028 22:48895620-48895642 ACACTTCTCAGACCTGGGAGAGG + Intergenic
1185328031 22:50237103-50237125 AGGCCTTTCAGACCCTGGAATGG - Intronic
951388189 3:22068663-22068685 AGGCCTTTCACATATGTGAGAGG - Intronic
953921366 3:46954213-46954235 AGGCCTTACAGATCTGGGGATGG - Intronic
954983821 3:54771551-54771573 TGGCCTTTGGGAGCTGGGAGTGG - Intronic
955118613 3:56031941-56031963 AGGTGTTTCAGTCATGGGAGTGG + Intronic
955764984 3:62334012-62334034 ATGCCTTTTAGAGCTGGGAAAGG + Exonic
955770346 3:62378736-62378758 CGGCTTTGCAGACCTGGGCGGGG + Intergenic
958169347 3:89918392-89918414 AGGCCTCCCAGGCCAGGGAGTGG - Intergenic
962985762 3:140534356-140534378 TGGCCTTGCAGACATGGGGGTGG - Intronic
965422609 3:168480744-168480766 TGGGCTTTCAGACTTGGGACAGG - Intergenic
969098658 4:4752703-4752725 AGGCCTTTCAAGCCTTGCAGTGG - Intergenic
970273251 4:14369035-14369057 ATGGCTTTGGGACCTGGGAGTGG + Intergenic
970432082 4:15998182-15998204 AAGCCTTTGAGACCTTGGAATGG - Intronic
970921963 4:21405087-21405109 AGGGTGATCAGACCTGGGAGAGG - Intronic
971221564 4:24712463-24712485 AGGCCCTTGATACCTGGGAGGGG + Intergenic
971485381 4:27154869-27154891 AGGCCTCTCAGAGCAGAGAGAGG + Intergenic
974226049 4:59046442-59046464 AGGACCTTCAGACCTGGATGGGG + Intergenic
975655320 4:76635593-76635615 AGGCCTTTCAGACCTGATTTAGG - Intronic
975803936 4:78092659-78092681 AGGCATTTCATAAATGGGAGTGG + Intronic
978802397 4:112767905-112767927 AGGTATTTCAGACTTGGGAGAGG - Intergenic
980869922 4:138599114-138599136 AGTCCTTTCACAGCTGTGAGAGG - Intergenic
981696326 4:147562922-147562944 AGGCCTTGCTGACCTGGGATGGG + Intergenic
982574994 4:157098406-157098428 AGCCCTTTCTGACCTTGGAGAGG - Intronic
984753473 4:183301417-183301439 AACCCTTTCAAACCAGGGAGAGG + Intronic
987886204 5:23816125-23816147 TGGCCTTTCAGACGTAGCAGTGG + Intergenic
988170843 5:27653173-27653195 AGGCCTATCTGTCATGGGAGAGG + Intergenic
989081791 5:37630521-37630543 AGGCCTCTCCCACCTGGCAGAGG + Intronic
990129243 5:52559355-52559377 AGGCACTTCTGACCTGGCAGCGG + Intergenic
990928246 5:61054365-61054387 ATGCAGTTCAGGCCTGGGAGAGG + Intronic
991777461 5:70099109-70099131 AGGCATTGCAGAGCTGGGAAAGG - Intergenic
991856749 5:70974553-70974575 AGGCATTGCAGAGCTGGGAAAGG - Intronic
994763637 5:103888273-103888295 AGGCATTTGAGACCAGGGAAAGG + Intergenic
995357709 5:111258478-111258500 AGGCCCTTCTTACCTGGCAGTGG + Intronic
998831192 5:146161425-146161447 AGAACTTTCAAAACTGGGAGTGG + Intronic
999177220 5:149639992-149640014 AGGCCCTACAGCCCTGGGGGAGG + Intergenic
1000054948 5:157597449-157597471 AGGCCTTTCAAGCCTGAGAATGG - Intergenic
1001419258 5:171574314-171574336 TGGCCTCTCAGAGCTGGAAGGGG - Intergenic
1001593931 5:172885797-172885819 AGGCCTTGCGGAGCTGGAAGAGG - Intronic
1001600456 5:172924860-172924882 AGGCCTTGCATACCTTGGTGAGG + Intronic
1002319343 5:178365776-178365798 AGTCCTCTGTGACCTGGGAGGGG + Intronic
1006148325 6:31972235-31972257 AGGCCCGTCAGTGCTGGGAGGGG - Exonic
1006645722 6:35512799-35512821 GGGCCTTCCAGACCTGTCAGAGG + Exonic
1007119512 6:39368540-39368562 ATGCCTTTCAGATCTGGGGCTGG + Intronic
1007577865 6:42937844-42937866 AGGCCCTTCAGCCCTTGGAAGGG + Intronic
1008482442 6:51999952-51999974 AGACCCTTCATACCTGGGAAAGG + Intronic
1009808351 6:68630788-68630810 AGGCATTTCCAACCTGTGAGTGG + Intergenic
1014242386 6:119032458-119032480 ATCCCTTCCAGACCAGGGAGGGG + Intronic
1014972843 6:127839863-127839885 GGGCCTGACAGACCTGGCAGAGG - Intronic
1019015890 6:168879043-168879065 GGGCCGTTCTGACCTGGGGGGGG - Intergenic
1019141004 6:169942767-169942789 AGGCCATTCAGAACTGGAAGTGG + Intergenic
1019706646 7:2500077-2500099 AGGCCTTTCAGGGCTAGGAACGG + Intergenic
1019901821 7:4026889-4026911 ACGCCTTTGAAACCAGGGAGCGG - Intronic
1020399198 7:7756026-7756048 AGAGCTTTGAGCCCTGGGAGCGG + Intronic
1021870536 7:25001899-25001921 AGGCCTTTCTGAGCTGCGATGGG + Intergenic
1022780896 7:33582182-33582204 AGGCCTATCAGACATCTGAGTGG + Intronic
1022995614 7:35752243-35752265 AGACCTTGCAGACCTTGGTGGGG + Intergenic
1023029697 7:36081351-36081373 GGGCCATTCAGACCTGGGAAAGG + Intronic
1024135797 7:46406707-46406729 GAGCCTTGCAGACCTGGGAAGGG + Intergenic
1024160104 7:46664980-46665002 AGAGCTTTCAGATCTGAGAGTGG - Intergenic
1030114827 7:106055135-106055157 AGGCTTTTAAGACCTGGCACAGG - Intergenic
1033231001 7:139597239-139597261 AGGGCTTTCGGAGCAGGGAGGGG + Intronic
1034291826 7:149938676-149938698 AGAGCTTTCAGATCTTGGAGGGG - Intergenic
1034814256 7:154158219-154158241 AGAGCTTTCAGATCTTGGAGGGG + Intronic
1035302865 7:157908343-157908365 AGGCCTTTCATGCCTGGGAGAGG + Intronic
1035572116 8:679465-679487 AGGCCTCACAGAGCTGCGAGGGG - Intronic
1039741836 8:40389933-40389955 AGGTCTTCCAGAGCTGGGATGGG - Intergenic
1042102339 8:65286776-65286798 TGACCGTTCAGGCCTGGGAGAGG + Intergenic
1042577634 8:70238442-70238464 AGAGCTTTGAGACCTTGGAGAGG - Intronic
1045371610 8:101529774-101529796 AGACCTTTCAGCCCTGGCAGGGG + Intronic
1045393218 8:101735473-101735495 AAGCCCTGCAGACCTGAGAGGGG - Intronic
1045459933 8:102416643-102416665 AGGTGTTACAGCCCTGGGAGAGG - Intergenic
1045595148 8:103646543-103646565 AGGCCTGTCGGAACTGGGTGCGG - Intronic
1049536819 8:143186315-143186337 GGCCCTTTCAGCCCTGGCAGAGG - Intergenic
1050013986 9:1213447-1213469 AGGCCTTTGTGACCCAGGAGTGG - Intergenic
1050144973 9:2557380-2557402 GGGCCTATCAGACGTGGGAATGG + Intergenic
1053751702 9:41263631-41263653 AGGCCTTGCTGAGCTGTGAGTGG + Intergenic
1054257229 9:62827960-62827982 AGGCCTTGCTGAGCTGTGAGTGG + Intergenic
1055893386 9:81147018-81147040 TGGCTTTCCAGACCTGGCAGAGG + Intergenic
1057038534 9:91830910-91830932 TGGCCTTTGAGACCTGGGAAGGG + Intronic
1057873227 9:98733547-98733569 AGGCCTTGCAGCCCTGGAAGTGG - Exonic
1058806825 9:108600945-108600967 CAGACTATCAGACCTGGGAGGGG - Intergenic
1060800062 9:126538308-126538330 AGGCCTTTCAGTTCAGTGAGAGG - Intergenic
1061059160 9:128242117-128242139 AGGCCTCAGAGAGCTGGGAGAGG + Intronic
1061652900 9:132065624-132065646 AGGCCTCTCAGATTCGGGAGTGG - Intronic
1061832099 9:133302844-133302866 AGGCCTTTCAGGACTGTTAGAGG - Intergenic
1062454167 9:136627936-136627958 TGGCCTTGCAGCCCTGGGGGTGG - Intergenic
1062535564 9:137019766-137019788 AGGCCGTGCTGCCCTGGGAGTGG - Intronic
1203492076 Un_GL000224v1:116617-116639 AGGCCTTGCTGAGCTGTGAGTGG + Intergenic
1203504700 Un_KI270741v1:58489-58511 AGGCCTTGCTGAGCTGTGAGTGG + Intergenic
1192191417 X:68993453-68993475 AGGCCTCTTAGACCTGGGAGAGG + Intergenic
1193073865 X:77334450-77334472 AGGCCTTGCAGAGCTGTGATGGG - Intergenic
1196920590 X:120581419-120581441 TGACCTTTCAGACCTGTGCGTGG + Intergenic
1199165907 X:144674934-144674956 ATTCCTTTGAGACCTGGGAGGGG - Intergenic
1199668192 X:150118894-150118916 AGGCCTTCCTGTCCTGGGACTGG + Intergenic
1200068771 X:153517772-153517794 AGGCCTTTCCATCCTTGGAGCGG + Intronic
1202015650 Y:20403717-20403739 AGTCCTTTAAGAACTGGGTGAGG + Intergenic