ID: 1070830575

View in Genome Browser
Species Human (GRCh38)
Location 10:79415656-79415678
Sequence AAAGGCCTTGTTGATTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830568_1070830575 -1 Left 1070830568 10:79415634-79415656 CCTGCACCCTCTCCCAGGTCTGA 0: 1
1: 0
2: 3
3: 34
4: 394
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830571_1070830575 -8 Left 1070830571 10:79415641-79415663 CCTCTCCCAGGTCTGAAAGGCCT 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830562_1070830575 12 Left 1070830562 10:79415621-79415643 CCCCTCACTCCTCCCTGCACCCT 0: 1
1: 0
2: 17
3: 163
4: 1328
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830559_1070830575 28 Left 1070830559 10:79415605-79415627 CCCAGGCTGAGGGTACCCCCTCA 0: 1
1: 0
2: 0
3: 9
4: 180
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830570_1070830575 -7 Left 1070830570 10:79415640-79415662 CCCTCTCCCAGGTCTGAAAGGCC 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830561_1070830575 13 Left 1070830561 10:79415620-79415642 CCCCCTCACTCCTCCCTGCACCC 0: 1
1: 0
2: 24
3: 260
4: 1913
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830566_1070830575 3 Left 1070830566 10:79415630-79415652 CCTCCCTGCACCCTCTCCCAGGT 0: 1
1: 0
2: 7
3: 79
4: 732
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830564_1070830575 10 Left 1070830564 10:79415623-79415645 CCTCACTCCTCCCTGCACCCTCT No data
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830563_1070830575 11 Left 1070830563 10:79415622-79415644 CCCTCACTCCTCCCTGCACCCTC 0: 1
1: 0
2: 12
3: 227
4: 3277
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830567_1070830575 0 Left 1070830567 10:79415633-79415655 CCCTGCACCCTCTCCCAGGTCTG 0: 1
1: 0
2: 2
3: 42
4: 530
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data
1070830560_1070830575 27 Left 1070830560 10:79415606-79415628 CCAGGCTGAGGGTACCCCCTCAC 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1070830575 10:79415656-79415678 AAAGGCCTTGTTGATTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830575 Original CRISPR AAAGGCCTTGTTGATTCTGG TGG Intronic
No off target data available for this crispr