ID: 1070830938

View in Genome Browser
Species Human (GRCh38)
Location 10:79417806-79417828
Sequence GCTCAGAGAAACGGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070830938_1070830950 5 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830950 10:79417834-79417856 GCCTTGGAATGGGAGGGAGTGGG 0: 1
1: 0
2: 4
3: 31
4: 380
1070830938_1070830954 10 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830954 10:79417839-79417861 GGAATGGGAGGGAGTGGGGGCGG No data
1070830938_1070830952 6 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830952 10:79417835-79417857 CCTTGGAATGGGAGGGAGTGGGG No data
1070830938_1070830955 20 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830955 10:79417849-79417871 GGAGTGGGGGCGGTGTGTTGAGG No data
1070830938_1070830944 -5 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830944 10:79417824-79417846 TGAGCCCTGAGCCTTGGAATGGG No data
1070830938_1070830945 -2 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830945 10:79417827-79417849 GCCCTGAGCCTTGGAATGGGAGG No data
1070830938_1070830943 -6 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830943 10:79417823-79417845 CTGAGCCCTGAGCCTTGGAATGG No data
1070830938_1070830949 4 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830949 10:79417833-79417855 AGCCTTGGAATGGGAGGGAGTGG No data
1070830938_1070830947 -1 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830947 10:79417828-79417850 CCCTGAGCCTTGGAATGGGAGGG No data
1070830938_1070830953 7 Left 1070830938 10:79417806-79417828 CCTGCTGCCCCGTTTCTCTGAGC No data
Right 1070830953 10:79417836-79417858 CTTGGAATGGGAGGGAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070830938 Original CRISPR GCTCAGAGAAACGGGGCAGC AGG (reversed) Intronic