ID: 1070832194

View in Genome Browser
Species Human (GRCh38)
Location 10:79424916-79424938
Sequence AGTAAACCTCACCACAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070832188_1070832194 10 Left 1070832188 10:79424883-79424905 CCCACGAAGCTCCAGGCTGAGCT 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG No data
1070832189_1070832194 9 Left 1070832189 10:79424884-79424906 CCACGAAGCTCCAGGCTGAGCTG 0: 1
1: 0
2: 2
3: 22
4: 256
Right 1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG No data
1070832192_1070832194 -1 Left 1070832192 10:79424894-79424916 CCAGGCTGAGCTGGGCCTGCACA 0: 1
1: 0
2: 4
3: 40
4: 390
Right 1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG No data
1070832187_1070832194 13 Left 1070832187 10:79424880-79424902 CCTCCCACGAAGCTCCAGGCTGA 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG No data
1070832185_1070832194 24 Left 1070832185 10:79424869-79424891 CCTCTCTGAGGCCTCCCACGAAG 0: 1
1: 0
2: 2
3: 31
4: 182
Right 1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG No data
1070832184_1070832194 27 Left 1070832184 10:79424866-79424888 CCTCCTCTCTGAGGCCTCCCACG 0: 1
1: 0
2: 2
3: 50
4: 398
Right 1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070832194 Original CRISPR AGTAAACCTCACCACAGCCC TGG Intronic
No off target data available for this crispr