ID: 1070835865

View in Genome Browser
Species Human (GRCh38)
Location 10:79446480-79446502
Sequence CAGAAATAGGAGAAGGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070835865_1070835879 20 Left 1070835865 10:79446480-79446502 CCCCCCCCCTTCTCCTATTTCTG No data
Right 1070835879 10:79446523-79446545 TCGACCCTCTTCCTCCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070835865 Original CRISPR CAGAAATAGGAGAAGGGGGG GGG (reversed) Intergenic
No off target data available for this crispr