ID: 1070838824

View in Genome Browser
Species Human (GRCh38)
Location 10:79469076-79469098
Sequence CCCCTCACGCATGTGTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070838824_1070838830 3 Left 1070838824 10:79469076-79469098 CCAATAAACACATGCGTGAGGGG No data
Right 1070838830 10:79469102-79469124 GGGGCTCCTCCCTGTGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070838824 Original CRISPR CCCCTCACGCATGTGTTTAT TGG (reversed) Intergenic
No off target data available for this crispr