ID: 1070839165

View in Genome Browser
Species Human (GRCh38)
Location 10:79471237-79471259
Sequence GCTATCTGGAAAATTACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070839165_1070839174 28 Left 1070839165 10:79471237-79471259 CCAGAGGTAATTTTCCAGATAGC No data
Right 1070839174 10:79471288-79471310 TCAGTTTCTCATGTTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070839165 Original CRISPR GCTATCTGGAAAATTACCTC TGG (reversed) Intergenic
No off target data available for this crispr