ID: 1070840872

View in Genome Browser
Species Human (GRCh38)
Location 10:79487079-79487101
Sequence GTGTTTGGGGGGACTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070840862_1070840872 20 Left 1070840862 10:79487036-79487058 CCTGTGGGAGGGAGGGGATGGAA No data
Right 1070840872 10:79487079-79487101 GTGTTTGGGGGGACTGTGGAGGG No data
1070840860_1070840872 24 Left 1070840860 10:79487032-79487054 CCTTCCTGTGGGAGGGAGGGGAT No data
Right 1070840872 10:79487079-79487101 GTGTTTGGGGGGACTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070840872 Original CRISPR GTGTTTGGGGGGACTGTGGA GGG Intergenic
No off target data available for this crispr