ID: 1070840980

View in Genome Browser
Species Human (GRCh38)
Location 10:79487727-79487749
Sequence CGCCCATGGTCTGGCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070840972_1070840980 11 Left 1070840972 10:79487693-79487715 CCCCGCTAAGGGATTTGGGTGGG No data
Right 1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG No data
1070840964_1070840980 24 Left 1070840964 10:79487680-79487702 CCTAGATCTCCCGCCCCGCTAAG No data
Right 1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG No data
1070840976_1070840980 9 Left 1070840976 10:79487695-79487717 CCGCTAAGGGATTTGGGTGGGGA No data
Right 1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG No data
1070840968_1070840980 15 Left 1070840968 10:79487689-79487711 CCCGCCCCGCTAAGGGATTTGGG No data
Right 1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG No data
1070840970_1070840980 14 Left 1070840970 10:79487690-79487712 CCGCCCCGCTAAGGGATTTGGGT No data
Right 1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG No data
1070840974_1070840980 10 Left 1070840974 10:79487694-79487716 CCCGCTAAGGGATTTGGGTGGGG No data
Right 1070840980 10:79487727-79487749 CGCCCATGGTCTGGCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070840980 Original CRISPR CGCCCATGGTCTGGCTGTGC AGG Intergenic
No off target data available for this crispr