ID: 1070841762

View in Genome Browser
Species Human (GRCh38)
Location 10:79492318-79492340
Sequence GTCTCACACCACCGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070841756_1070841762 -8 Left 1070841756 10:79492303-79492325 CCTTCCGGGACCTCAGTCTCACA No data
Right 1070841762 10:79492318-79492340 GTCTCACACCACCGGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070841762 Original CRISPR GTCTCACACCACCGGGTCCT GGG Intergenic
No off target data available for this crispr