ID: 1070842722

View in Genome Browser
Species Human (GRCh38)
Location 10:79498786-79498808
Sequence GTAAGATTCTCATAAGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070842722_1070842724 -3 Left 1070842722 10:79498786-79498808 CCGGCTCCTTATGAGAATCTTAC No data
Right 1070842724 10:79498806-79498828 TACTAATGCCTAATGATCTGAGG No data
1070842722_1070842725 0 Left 1070842722 10:79498786-79498808 CCGGCTCCTTATGAGAATCTTAC No data
Right 1070842725 10:79498809-79498831 TAATGCCTAATGATCTGAGGTGG 0: 32
1: 903
2: 1060
3: 672
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070842722 Original CRISPR GTAAGATTCTCATAAGGAGC CGG (reversed) Intergenic
No off target data available for this crispr