ID: 1070843248

View in Genome Browser
Species Human (GRCh38)
Location 10:79502697-79502719
Sequence GTTTGCCTCCTCTGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070843248_1070843260 20 Left 1070843248 10:79502697-79502719 CCCACCCCACAGAGGAGGCAAAC No data
Right 1070843260 10:79502740-79502762 CCCCTGGAAGTCCCTGCTTCAGG No data
1070843248_1070843256 4 Left 1070843248 10:79502697-79502719 CCCACCCCACAGAGGAGGCAAAC No data
Right 1070843256 10:79502724-79502746 GACAGGGCAGCCCTTTCCCCTGG No data
1070843248_1070843262 21 Left 1070843248 10:79502697-79502719 CCCACCCCACAGAGGAGGCAAAC No data
Right 1070843262 10:79502741-79502763 CCCTGGAAGTCCCTGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070843248 Original CRISPR GTTTGCCTCCTCTGTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr