ID: 1070844392

View in Genome Browser
Species Human (GRCh38)
Location 10:79510084-79510106
Sequence GCCTGTGCTCCGCTATTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070844386_1070844392 19 Left 1070844386 10:79510042-79510064 CCAAGACATCAGGGTGGAATGAT No data
Right 1070844392 10:79510084-79510106 GCCTGTGCTCCGCTATTCACAGG No data
1070844391_1070844392 -6 Left 1070844391 10:79510067-79510089 CCACAGTCAGTGGAGGGGCCTGT No data
Right 1070844392 10:79510084-79510106 GCCTGTGCTCCGCTATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070844392 Original CRISPR GCCTGTGCTCCGCTATTCAC AGG Intergenic
No off target data available for this crispr