ID: 1070845003

View in Genome Browser
Species Human (GRCh38)
Location 10:79514454-79514476
Sequence GGAAACACCCTGACTTTTGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 2, 1: 0, 2: 0, 3: 41, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070845002_1070845003 -4 Left 1070845002 10:79514435-79514457 CCAGGAATAGAGGTGGACAGGAA 0: 2
1: 1
2: 2
3: 18
4: 193
Right 1070845003 10:79514454-79514476 GGAAACACCCTGACTTTTGTAGG 0: 2
1: 0
2: 0
3: 41
4: 145
1070844998_1070845003 12 Left 1070844998 10:79514419-79514441 CCAGAAGAGTCACACGCCAGGAA 0: 2
1: 1
2: 1
3: 11
4: 109
Right 1070845003 10:79514454-79514476 GGAAACACCCTGACTTTTGTAGG 0: 2
1: 0
2: 0
3: 41
4: 145
1070844997_1070845003 13 Left 1070844997 10:79514418-79514440 CCCAGAAGAGTCACACGCCAGGA 0: 2
1: 1
2: 0
3: 9
4: 127
Right 1070845003 10:79514454-79514476 GGAAACACCCTGACTTTTGTAGG 0: 2
1: 0
2: 0
3: 41
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070845003 Original CRISPR GGAAACACCCTGACTTTTGT AGG Exonic
901074085 1:6541698-6541720 GGAAAGACCATGAGTTTGGTAGG + Intronic
901636310 1:10671874-10671896 AGAAACACCCTGCCTTTTCACGG + Intronic
901759536 1:11461784-11461806 GGACACACACTGACATTTCTGGG - Intergenic
902791980 1:18775580-18775602 GAGAACACCCTGACTGTGGTAGG + Intergenic
905677851 1:39841819-39841841 GGAAACACTCTGACTTTCTATGG + Exonic
907149551 1:52270854-52270876 GAAATCACCCTCACTTATGTAGG - Intronic
910720775 1:90284180-90284202 TGAGACACTCTGAGTTTTGTGGG - Intergenic
911096651 1:94060621-94060643 GGAGACACCCTGATTTTTCAAGG + Exonic
911195829 1:94994442-94994464 GGAAACACACTGACATTTTCTGG + Intronic
913360472 1:117975143-117975165 GGAAATAGCCTGTCCTTTGTAGG + Intronic
913703811 1:121398080-121398102 GGAAAAACCTTAACTTTTGTGGG + Intergenic
913980162 1:143499789-143499811 GGAAAAACCTTAACTTTTGTGGG + Intergenic
914074510 1:144325274-144325296 GGAAAAACCTTAACTTTTGTGGG + Intergenic
914104666 1:144641172-144641194 GGAAAAACCTTAACTTTTGTGGG - Intergenic
915448908 1:155990921-155990943 GGAAAGCCCCTGACCTTTGGAGG + Intronic
915698733 1:157770387-157770409 GGTAAAACCCTGACTTCTGTGGG - Exonic
916823834 1:168425848-168425870 GTAAGCACCCAGACTTTTATGGG + Intergenic
918090649 1:181291207-181291229 GGAAACACCCTTTCCCTTGTAGG - Intergenic
918425712 1:184407677-184407699 TGAAGCATCATGACTTTTGTGGG + Intronic
921676519 1:217982576-217982598 AGAAACATCCAGACTCTTGTTGG + Intergenic
922325593 1:224525476-224525498 GGACACACCCTGACTGTGGAAGG - Intronic
923720899 1:236465789-236465811 GGAAAACCACTGATTTTTGTGGG - Intronic
1065118059 10:22501305-22501327 GGAAACAAGATGACTTGTGTTGG - Intergenic
1066095174 10:32065393-32065415 GGAAGCTCCCTGACATTGGTAGG - Intergenic
1066780930 10:38943590-38943612 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1068562345 10:58529034-58529056 TGCAACACCCTGAATTCTGTGGG + Intronic
1070845003 10:79514454-79514476 GGAAACACCCTGACTTTTGTAGG + Exonic
1070928801 10:80245855-80245877 GGAAACACCCTGACTTTTGTAGG - Intergenic
1070956426 10:80466633-80466655 TGAAACACCCCCACTTTGGTGGG + Intronic
1071289258 10:84176806-84176828 GGAAACACACTTACTTTAGGTGG + Intronic
1078290704 11:10007554-10007576 GAAACAACCCTGACCTTTGTTGG + Intronic
1079525057 11:21376607-21376629 GGAAAAACACTGAATTTTGTAGG + Intronic
1082099456 11:48160214-48160236 GGCAACCCCTTGACTTTTCTGGG + Intronic
1083350499 11:62025056-62025078 GGAAACACACTGACTGTCTTTGG - Intergenic
1085746493 11:79119298-79119320 AGAAATACCCAGACATTTGTTGG - Intronic
1087937393 11:104050636-104050658 GGAAACACCCAGAAATGTGTGGG + Intronic
1088424926 11:109692829-109692851 GGGAACCCCTTAACTTTTGTGGG + Intergenic
1088452162 11:109993877-109993899 GGAAATACCCAAACTTTTCTGGG + Intergenic
1088724135 11:112619612-112619634 GGAACCACCCTGCCTTTGCTGGG - Intergenic
1092003885 12:5052667-5052689 GGAAACTCACTGACTGATGTGGG + Intergenic
1092897091 12:13022445-13022467 GGAAATACCCAGATTTTTGAGGG - Intergenic
1093252021 12:16818239-16818261 TGAAACACCCTCACATTTTTAGG - Intergenic
1094326990 12:29251393-29251415 GGAAATAACCAGACTTTTGAGGG + Intronic
1095694322 12:45127442-45127464 GGAAACACACTGAATTATTTAGG - Intergenic
1095874568 12:47066624-47066646 GGAATAACCATAACTTTTGTGGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101968849 12:109298683-109298705 GCAAAGACCCCGACATTTGTGGG + Intronic
1102155873 12:110727310-110727332 GGAAACAAACTGATTTTTGATGG - Intronic
1103442243 12:120971905-120971927 GGAAACACAGTGACATCTGTTGG + Intergenic
1104363282 12:128153725-128153747 GGAGAAACCCTAACGTTTGTGGG - Intergenic
1105534238 13:21248863-21248885 GGTAAAACCCTGACTGTGGTGGG - Intergenic
1111560615 13:89940135-89940157 GGAAATGGCCTGACTTTTCTAGG + Intergenic
1112243241 13:97702957-97702979 TGAAACATGCTGTCTTTTGTGGG - Intergenic
1114374739 14:22132229-22132251 GGAAACACACTGAGTCTTTTGGG - Intergenic
1116860350 14:49990551-49990573 GGAAAAAACCTGACTTTCCTTGG + Intronic
1122395631 14:101427533-101427555 GTAAACCCCTTGACTTTTCTAGG - Intergenic
1122807707 14:104268891-104268913 GGACACACCATGCCTTTTGGTGG + Intergenic
1202939656 14_KI270725v1_random:135564-135586 GGAAAAACCTTAACTTTTGTGGG - Intergenic
1123393483 15:19900329-19900351 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1130832432 15:87615382-87615404 GGAAATACCCTGCCTTCTCTGGG + Intergenic
1131570998 15:93535847-93535869 GGACATACCATGACTTTTGTGGG + Intergenic
1133492819 16:6287284-6287306 GGCAACACCATGACTATTTTTGG - Intronic
1134166233 16:11932091-11932113 GGAAATACCCTGGCCTTTGTAGG + Intronic
1134494485 16:14721634-14721656 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134499866 16:14760754-14760776 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134526412 16:14947373-14947395 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134545993 16:15108973-15108995 GGAAATACCGTGGCCTTTGTAGG + Intronic
1134580713 16:15368296-15368318 GGAAATACCCTGGCCTTTGTAGG + Intronic
1134713989 16:16345846-16345868 GGAAATACCCTGGCCTTTGTAGG - Intergenic
1134721862 16:16389209-16389231 GGAAATACCCTGGCCTTTGTAGG - Intronic
1134945563 16:18322660-18322682 GGAAATACCCTGGCCTTTGTAGG + Intronic
1134952828 16:18362812-18362834 GGAAATACCCTGGCCTTTGTAGG + Intergenic
1135311624 16:21409516-21409538 GGAAATACCCTGGCCTTTGTAGG + Intronic
1135364576 16:21841968-21841990 GGAAATACCCTGGCCTTTGTAGG + Intronic
1135447267 16:22529381-22529403 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136150789 16:28347425-28347447 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136167025 16:28461263-28461285 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136195950 16:28653769-28653791 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136212288 16:28767892-28767914 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136257011 16:29047804-29047826 GGAAATACCCTGGCCTTTGTAGG - Intronic
1136308329 16:29388512-29388534 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136321746 16:29490050-29490072 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136436426 16:30230020-30230042 GGAAATACCCTGGCCTTTGTAGG + Intronic
1136699484 16:32117704-32117726 GGAAAAACCTTAACTTTTGTGGG + Intergenic
1136715777 16:32279885-32279907 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1136752136 16:32649882-32649904 GGGAAAACCTTAACTTTTGTGGG - Intergenic
1136799975 16:33060875-33060897 GGAAAAACCTTAACTTTTGTGGG + Intergenic
1136868133 16:33772023-33772045 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1139856025 16:69980939-69980961 GGAAATACCCTGGCCTTTGTAGG + Intergenic
1140366703 16:74387139-74387161 GGAAATACCCTGGCCTTTCTAGG - Intronic
1141220161 16:82062030-82062052 GGAAACACCCCATCATTTGTTGG - Intronic
1203054277 16_KI270728v1_random:909866-909888 GGGAAAACCTTAACTTTTGTGGG - Intergenic
1203104042 16_KI270728v1_random:1344253-1344275 GGGAAAACCTTAACTTTTGTGGG - Intergenic
1203129472 16_KI270728v1_random:1618115-1618137 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1145710173 17:26963887-26963909 GGTAAAACCTTAACTTTTGTGGG + Intergenic
1147163619 17:38581857-38581879 GGCAACCCTCTGACTTTGGTTGG - Intronic
1148495629 17:48051868-48051890 GTAAACACCCTGGCATGTGTAGG - Intronic
1148920346 17:51026153-51026175 GAAAATAACCTGCCTTTTGTGGG - Intronic
1152145389 17:78565437-78565459 AGGAACATCCTGACGTTTGTCGG + Intronic
1154117496 18:11624148-11624170 GGAAATACCCTGGCCTTTGTAGG + Intergenic
1154518083 18:15196747-15196769 GGAAAAACCTTAATTTTTGTGGG - Intergenic
1161869644 19:6860413-6860435 AGCAACTCCCTGGCTTTTGTTGG - Intergenic
1162862354 19:13516017-13516039 GGAAACACACTGAATTATATAGG + Intronic
1164661159 19:29969677-29969699 GAAAACATCCTGACTGTTCTTGG + Intronic
1202679983 1_KI270712v1_random:1681-1703 GGAAAAACCTTAACTTTTGTGGG - Intergenic
931246636 2:60497957-60497979 TGCAACACCCTGACCTTTATGGG - Intronic
934251366 2:90359016-90359038 GGGAAAACCTTAACTTTTGTGGG - Intergenic
934258194 2:91444382-91444404 GGGAAAACCTTAACTTTTGTGGG + Intergenic
934487460 2:94729207-94729229 TGAGACACTCTGAGTTTTGTGGG + Intergenic
935337190 2:102027304-102027326 GGGAACATTCTGATTTTTGTGGG - Intronic
938517999 2:132036996-132037018 GGGAAAACCTTAACTTTTGTGGG - Intergenic
938691911 2:133799676-133799698 GGAAACACCCTGCAGTTTGGTGG - Intergenic
940617859 2:156073369-156073391 GGCAACACCCGGAATTGTGTGGG - Intergenic
944178547 2:196861654-196861676 GGAGAAACCCTGTCTGTTGTGGG + Intronic
944220093 2:197294774-197294796 GGAAATAGCCTTAATTTTGTAGG - Intronic
944222264 2:197314211-197314233 GGAAATACCCAGACATTTGAGGG + Intergenic
945837280 2:214848142-214848164 GTGATCACCCTGATTTTTGTAGG + Intergenic
1170998562 20:21391247-21391269 GGAAACAGCCTGACTACTCTGGG + Intergenic
1171462103 20:25303727-25303749 GGAAACAGCCTGATTTCTGCTGG + Intronic
1172196503 20:33095354-33095376 GGAAAGACCCTGAATTCTATAGG + Intronic
1172855772 20:38001092-38001114 TGGAACTCCCTGTCTTTTGTGGG - Intronic
1176155831 20:63619926-63619948 GGAAACGCCCTGGGTTTTTTTGG + Intronic
1176583533 21:8551521-8551543 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1176612277 21:8994013-8994035 GGACAAACCCTGACTTATGATGG - Intergenic
1179091384 21:38269032-38269054 GGAATTTCCCTGCCTTTTGTAGG - Intronic
1179570377 21:42275076-42275098 GGAGAGACCCTGACTTGGGTTGG + Intronic
1180266343 22:10528452-10528474 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1180930632 22:19588354-19588376 GGGAACACCCTGCGTTTTGATGG - Intergenic
1182845479 22:33427486-33427508 GGAAACTGACTGACTCTTGTAGG + Intronic
950808078 3:15625479-15625501 GGAGGCACCCGCACTTTTGTAGG - Intronic
951854860 3:27184671-27184693 GGAAAAACCATGACTTGTTTTGG - Intronic
953847114 3:46436423-46436445 GGAAACACCCTGGCTGGTGAGGG - Intronic
956596259 3:70970927-70970949 GGAGAAAGCCTGACTTTTCTTGG - Intronic
963857077 3:150265901-150265923 GGCTGCATCCTGACTTTTGTGGG + Intergenic
966175376 3:177132749-177132771 GTAGCCACCCTTACTTTTGTGGG - Intronic
966176648 3:177145625-177145647 TGAAACACCCAGACCTTTCTGGG + Intronic
970692105 4:18631562-18631584 GGAAAAACATTGACTATTGTGGG - Intergenic
971137949 4:23890260-23890282 GGAAACACTTAGACTTTTGGAGG + Intronic
974393517 4:61305641-61305663 GGAAAGACCCTATCTTTTGGGGG - Intronic
974487188 4:62521618-62521640 GGAAACATCCTTACCTTTGAAGG - Intergenic
975389916 4:73803657-73803679 GGAGACACTCTGTCTTTTATAGG - Intergenic
979134583 4:117093856-117093878 GGAAAATTCCAGACTTTTGTTGG - Intergenic
982061061 4:151604444-151604466 GGAAACACAGTGACATCTGTTGG + Intronic
984946826 4:184975408-184975430 GGCATCACCGTGACTTGTGTGGG + Intergenic
985385017 4:189436421-189436443 GGAAACACCCAGACTCTTAGTGG - Intergenic
987903971 5:24051337-24051359 GGAAAGACCCAGAATTTTGTTGG + Intronic
988995476 5:36710941-36710963 GGAAAAACCGAGACTTTTGAGGG - Intergenic
992981949 5:82184588-82184610 GACCACATCCTGACTTTTGTGGG + Intronic
1001145639 5:169181907-169181929 GGGAACATCTTGACTTTTGGAGG - Intronic
1003157838 6:3611398-3611420 GAAAAGATCATGACTTTTGTTGG - Intergenic
1003376880 6:5587971-5587993 GGTAAAACCCTGACTGTGGTGGG + Intronic
1003950229 6:11109553-11109575 GAAACAACCCTGACCTTTGTTGG - Intronic
1007924399 6:45640017-45640039 GGAGAAACACTGATTTTTGTTGG + Intronic
1009608917 6:65912113-65912135 GGAAATACCCTGGATTTTTTGGG - Intergenic
1009679713 6:66875725-66875747 GGGAACTCCCTAACTCTTGTGGG - Intergenic
1013405268 6:109837726-109837748 GGAGACACCCTGACTTTGGGAGG + Intergenic
1016100631 6:140095615-140095637 TGAAATTCCCTCACTTTTGTTGG + Intergenic
1016852745 6:148638094-148638116 GTGAAGCCCCTGACTTTTGTGGG + Intergenic
1017630423 6:156391522-156391544 GGAAACAGCCTGAGTTTTTCAGG - Intergenic
1018996949 6:168717227-168717249 GGAAACACCCCCACTCCTGTTGG - Intergenic
1019155034 6:170032915-170032937 GGAAACACCCTGTTCTTTATGGG - Intergenic
1020796476 7:12683821-12683843 GGAAACACAGTGACATCTGTTGG - Intergenic
1024800575 7:53073178-53073200 GGAATCACCCTGCCTTCTGAGGG + Intergenic
1025482090 7:60993687-60993709 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1025562211 7:62381785-62381807 GGAAAAACCTTAACTTTTGTGGG + Intergenic
1025760812 7:64389528-64389550 GGAAATACCCTGGCCTTTGTAGG - Intergenic
1032463221 7:132126957-132126979 GGAGAGACCCTGACATTTCTTGG - Exonic
1036087114 8:5624279-5624301 GGCATCACCTTGACTTTTGGAGG + Intergenic
1038238931 8:25789945-25789967 AGAAACACGCTGAGTTTTGTGGG + Intergenic
1041745798 8:61207964-61207986 GGATACACCCTGATTATTGCAGG + Intronic
1044510059 8:93066069-93066091 GGAAACATCCTCACTTCTTTTGG + Intergenic
1047521286 8:125597143-125597165 GGAAAGACCATGAGTTCTGTGGG - Intergenic
1050651636 9:7783230-7783252 GGAAACACACTGACTGTTTTTGG - Intergenic
1051208513 9:14715387-14715409 GGAAACATCCTCACTGTTATAGG + Intergenic
1051302125 9:15663172-15663194 GGATTCAGCCTGAGTTTTGTTGG + Intronic
1053920135 9:42981486-42981508 TGAGACACTCTGAGTTTTGTGGG - Intergenic
1057481531 9:95448648-95448670 GGAAAAAACCTGACCTCTGTTGG + Intronic
1057592676 9:96386277-96386299 GGAAAAACCCTTACTTTTGAAGG + Exonic
1062134591 9:134918291-134918313 GGACAAACCCTGAATTTTCTGGG - Intergenic
1203613493 Un_KI270749v1:29292-29314 GGGAAAACCTTAACTTTTGTGGG + Intergenic
1186272302 X:7901915-7901937 GGAAACACGTTGAATTCTGTGGG + Intronic
1189605520 X:42673693-42673715 GGAAAAAGCCAGAATTTTGTAGG - Intergenic
1192269756 X:69567647-69567669 GAGTACACCATGACTTTTGTGGG - Intergenic
1196437802 X:115690958-115690980 GGAAACAGTCTGTCTTTTGTGGG + Intergenic
1197345924 X:125325912-125325934 ACAAACACCTTAACTTTTGTTGG + Intergenic
1199480094 X:148288851-148288873 GGAATTAACCTGACTTTTGGGGG - Intergenic
1200700517 Y:6398287-6398309 GCAAACAAGCTGACTTGTGTGGG + Intergenic
1201033595 Y:9766411-9766433 GCAAACAAGCTGACTTGTGTGGG - Intergenic