ID: 1070846356

View in Genome Browser
Species Human (GRCh38)
Location 10:79525191-79525213
Sequence ACGGCTACATCCACCTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070846356_1070846359 4 Left 1070846356 10:79525191-79525213 CCTTTGAAGGTGGATGTAGCCGT No data
Right 1070846359 10:79525218-79525240 TGTGACTCAGGAGCTGTGAGTGG No data
1070846356_1070846357 -8 Left 1070846356 10:79525191-79525213 CCTTTGAAGGTGGATGTAGCCGT No data
Right 1070846357 10:79525206-79525228 GTAGCCGTGTGATGTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070846356 Original CRISPR ACGGCTACATCCACCTTCAA AGG (reversed) Intergenic
No off target data available for this crispr