ID: 1070846637

View in Genome Browser
Species Human (GRCh38)
Location 10:79527733-79527755
Sequence GAACCCTTCCTGGCTAACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070846629_1070846637 25 Left 1070846629 10:79527685-79527707 CCAGCACTGTGGGAGGCCGAGGC 0: 689
1: 85909
2: 213551
3: 223810
4: 149624
Right 1070846637 10:79527733-79527755 GAACCCTTCCTGGCTAACACGGG No data
1070846633_1070846637 9 Left 1070846633 10:79527701-79527723 CCGAGGCAGGTGGATCACAAGGT 0: 2218
1: 11744
2: 31060
3: 53139
4: 65038
Right 1070846637 10:79527733-79527755 GAACCCTTCCTGGCTAACACGGG No data
1070846627_1070846637 26 Left 1070846627 10:79527684-79527706 CCCAGCACTGTGGGAGGCCGAGG 0: 1040
1: 127180
2: 276713
3: 209477
4: 120768
Right 1070846637 10:79527733-79527755 GAACCCTTCCTGGCTAACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070846637 Original CRISPR GAACCCTTCCTGGCTAACAC GGG Intergenic
No off target data available for this crispr