ID: 1070862917

View in Genome Browser
Species Human (GRCh38)
Location 10:79686744-79686766
Sequence GGCACCCATGTCCCTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070862907_1070862917 26 Left 1070862907 10:79686695-79686717 CCCTCTTGGGGATACCAGGCATT No data
Right 1070862917 10:79686744-79686766 GGCACCCATGTCCCTTCCCAGGG No data
1070862906_1070862917 27 Left 1070862906 10:79686694-79686716 CCCCTCTTGGGGATACCAGGCAT No data
Right 1070862917 10:79686744-79686766 GGCACCCATGTCCCTTCCCAGGG No data
1070862912_1070862917 12 Left 1070862912 10:79686709-79686731 CCAGGCATTGGAAGGACACAGGT No data
Right 1070862917 10:79686744-79686766 GGCACCCATGTCCCTTCCCAGGG No data
1070862908_1070862917 25 Left 1070862908 10:79686696-79686718 CCTCTTGGGGATACCAGGCATTG No data
Right 1070862917 10:79686744-79686766 GGCACCCATGTCCCTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070862917 Original CRISPR GGCACCCATGTCCCTTCCCA GGG Intergenic
No off target data available for this crispr