ID: 1070863793

View in Genome Browser
Species Human (GRCh38)
Location 10:79693830-79693852
Sequence CAGGAATCCATTTGTACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070863785_1070863793 22 Left 1070863785 10:79693785-79693807 CCCTCATTATGTTAGGGCAGGAC No data
Right 1070863793 10:79693830-79693852 CAGGAATCCATTTGTACCACAGG No data
1070863786_1070863793 21 Left 1070863786 10:79693786-79693808 CCTCATTATGTTAGGGCAGGACA No data
Right 1070863793 10:79693830-79693852 CAGGAATCCATTTGTACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070863793 Original CRISPR CAGGAATCCATTTGTACCAC AGG Intergenic
No off target data available for this crispr