ID: 1070863977

View in Genome Browser
Species Human (GRCh38)
Location 10:79694869-79694891
Sequence CTGGTGCTAAGGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070863977_1070863985 2 Left 1070863977 10:79694869-79694891 CCCTCCTCACTCCTTAGCACCAG No data
Right 1070863985 10:79694894-79694916 CTGGCTGTACATCCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070863977 Original CRISPR CTGGTGCTAAGGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr