ID: 1070864707

View in Genome Browser
Species Human (GRCh38)
Location 10:79700830-79700852
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070864707_1070864713 -7 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864713 10:79700846-79700868 GGAGGGCCCCGCTGGAGATGTGG No data
1070864707_1070864723 27 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864723 10:79700880-79700902 CGCGGCACCTGGGTGCTTCCTGG No data
1070864707_1070864724 28 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864707_1070864721 16 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864721 10:79700869-79700891 AAATGGAGGGACGCGGCACCTGG No data
1070864707_1070864725 29 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864725 10:79700882-79700904 CGGCACCTGGGTGCTTCCTGGGG No data
1070864707_1070864719 3 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864719 10:79700856-79700878 GCTGGAGATGTGGAAATGGAGGG No data
1070864707_1070864720 9 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864720 10:79700862-79700884 GATGTGGAAATGGAGGGACGCGG No data
1070864707_1070864718 2 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data
1070864707_1070864715 -1 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864715 10:79700852-79700874 CCCCGCTGGAGATGTGGAAATGG No data
1070864707_1070864722 17 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864722 10:79700870-79700892 AATGGAGGGACGCGGCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070864707 Original CRISPR GCCCTCCTAGGGCGGGCTCC TGG (reversed) Intergenic