ID: 1070864709

View in Genome Browser
Species Human (GRCh38)
Location 10:79700838-79700860
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070864709_1070864725 21 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864725 10:79700882-79700904 CGGCACCTGGGTGCTTCCTGGGG No data
1070864709_1070864718 -6 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data
1070864709_1070864720 1 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864720 10:79700862-79700884 GATGTGGAAATGGAGGGACGCGG No data
1070864709_1070864722 9 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864722 10:79700870-79700892 AATGGAGGGACGCGGCACCTGGG No data
1070864709_1070864724 20 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864709_1070864715 -9 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864715 10:79700852-79700874 CCCCGCTGGAGATGTGGAAATGG No data
1070864709_1070864723 19 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864723 10:79700880-79700902 CGCGGCACCTGGGTGCTTCCTGG No data
1070864709_1070864719 -5 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864719 10:79700856-79700878 GCTGGAGATGTGGAAATGGAGGG No data
1070864709_1070864721 8 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864721 10:79700869-79700891 AAATGGAGGGACGCGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070864709 Original CRISPR CCAGCGGGGCCCTCCTAGGG CGG (reversed) Intergenic
No off target data available for this crispr