ID: 1070864712

View in Genome Browser
Species Human (GRCh38)
Location 10:79700842-79700864
Sequence ATCTCCAGCGGGGCCCTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070864712_1070864725 17 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864725 10:79700882-79700904 CGGCACCTGGGTGCTTCCTGGGG No data
1070864712_1070864724 16 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864712_1070864720 -3 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864720 10:79700862-79700884 GATGTGGAAATGGAGGGACGCGG No data
1070864712_1070864723 15 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864723 10:79700880-79700902 CGCGGCACCTGGGTGCTTCCTGG No data
1070864712_1070864719 -9 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864719 10:79700856-79700878 GCTGGAGATGTGGAAATGGAGGG No data
1070864712_1070864721 4 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864721 10:79700869-79700891 AAATGGAGGGACGCGGCACCTGG No data
1070864712_1070864722 5 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864722 10:79700870-79700892 AATGGAGGGACGCGGCACCTGGG No data
1070864712_1070864718 -10 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070864712 Original CRISPR ATCTCCAGCGGGGCCCTCCT AGG (reversed) Intergenic