ID: 1070864716

View in Genome Browser
Species Human (GRCh38)
Location 10:79700853-79700875
Sequence TCCATTTCCACATCTCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070864716_1070864724 5 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864716_1070864722 -6 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864722 10:79700870-79700892 AATGGAGGGACGCGGCACCTGGG No data
1070864716_1070864725 6 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864725 10:79700882-79700904 CGGCACCTGGGTGCTTCCTGGGG No data
1070864716_1070864721 -7 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864721 10:79700869-79700891 AAATGGAGGGACGCGGCACCTGG No data
1070864716_1070864723 4 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864723 10:79700880-79700902 CGCGGCACCTGGGTGCTTCCTGG No data
1070864716_1070864728 28 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864728 10:79700904-79700926 GCCAGACAACGCCCCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070864716 Original CRISPR TCCATTTCCACATCTCCAGC GGG (reversed) Intergenic
No off target data available for this crispr