ID: 1070864718

View in Genome Browser
Species Human (GRCh38)
Location 10:79700855-79700877
Sequence CGCTGGAGATGTGGAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070864707_1070864718 2 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data
1070864711_1070864718 -9 Left 1070864711 10:79700841-79700863 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data
1070864701_1070864718 25 Left 1070864701 10:79700807-79700829 CCTGCGGCGGCACACGGGGCAGG No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data
1070864712_1070864718 -10 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data
1070864708_1070864718 -5 Left 1070864708 10:79700837-79700859 CCCGCCCTAGGAGGGCCCCGCTG No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data
1070864709_1070864718 -6 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864718 10:79700855-79700877 CGCTGGAGATGTGGAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070864718 Original CRISPR CGCTGGAGATGTGGAAATGG AGG Intergenic
No off target data available for this crispr