ID: 1070864724

View in Genome Browser
Species Human (GRCh38)
Location 10:79700881-79700903
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070864707_1070864724 28 Left 1070864707 10:79700830-79700852 CCAGGAGCCCGCCCTAGGAGGGC No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864717_1070864724 4 Left 1070864717 10:79700854-79700876 CCGCTGGAGATGTGGAAATGGAG No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864708_1070864724 21 Left 1070864708 10:79700837-79700859 CCCGCCCTAGGAGGGCCCCGCTG No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864711_1070864724 17 Left 1070864711 10:79700841-79700863 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864716_1070864724 5 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864709_1070864724 20 Left 1070864709 10:79700838-79700860 CCGCCCTAGGAGGGCCCCGCTGG No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864712_1070864724 16 Left 1070864712 10:79700842-79700864 CCTAGGAGGGCCCCGCTGGAGAT No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data
1070864714_1070864724 6 Left 1070864714 10:79700852-79700874 CCCCGCTGGAGATGTGGAAATGG No data
Right 1070864724 10:79700881-79700903 GCGGCACCTGGGTGCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070864724 Original CRISPR GCGGCACCTGGGTGCTTCCT GGG Intergenic